Entry information : ApruAPx-CcP01
Entry ID 12275
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: ApruAPx-CcP01
Name ApruAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Botryosphaeriaceae Aplosporella
Organism Aplosporella prunicola    [TaxId: 462254 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ApruAPx-CcP01
start..stop
S start..stop
ApruAPx-CcP03 535 0 1..532 1..532
SsclAPx-CcP01 501 1e-173 1..530 1..529
BdotAPx-CcP02 496 3e-172 1..534 1..531
BfuAPx-CcP02 490 7e-170 1..533 1..533
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 33048..33189 142 N° 2 32943..32997 55 N° 3 31483..32890 1408  
complement(join(31483..32890,32943..32997,33048..33189))


exon

Literature and cross-references ApruAPx-CcP01
DNA ref. JGI genome:   scaffold_74 (33189..31483)
Cluster/Prediction ref. JGI gene:   260034
Protein sequence: ApruAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   535 (515)
PWM (Da):   %s   58355.53 (56473.5)  
PI (pH):   %s   4.65 (4.61) Peptide Signal:   %s   cut: 20 range:20-534
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSLSIAGASLLSLLPASAEYIWPSQYDEIEDVWSLQSGYVHHGFRDNVTPCTFGDSKSQLTAAEWLRTAYHDFATHDTSTGLGGVDASIMYELERDENTGAGFNGSLGFFLNYYSNKASMADLVALGAIVSVEACGGPRIPFRAGRIDATEAGRMGVPKPDEDIDTHKKEFAAAGFNVSDMIAVVACGHTFGGVHGNDFPQITGVDSEDNFPKFENGDESAHVFDNNVVTEYLDDSTSNPLVKSSNKTFISDHRVFSSDGNVTMKALADPKAFQSTCKDVLARMIDTVPSAVKLSDVLTPPEMKPYELSLTLTEKNTLHFEGKIRVRTTEIGSMNAQAVTLTYTDRNGKTASNKTIETMHGRYQGGTSSGFGEVFDWFEIDTELPIDTSISKFDITLTKPDGKTVYNNAGHGFPIQDSILYDQTKSCMSLPDANNKRTVKVVAYVRSERANDPVSFNFYQKIERQGVIVPKLDTLNQKMTKVEGSEKNGYVQFTGEAEVSLGQFGTTLDVLVGEGDNVDIVDFKRTNYLTQCA

Retrieve as FASTA  
Remarks complete sequence from genomics (2 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTCTCTCTCTATTGCTGGCGCGAGCCTGCTTTCCCTCCTTCCTGCGTCCGCCGAGTATATTTGGCCGTCTCAGTATGACGAGATTGAAGACGTCTGGAGTCTTCAATCTGGCTAC
GTCCATCACGGTTTCCGCGATA
GTAAGTTGACCAACCTATCAATCACCACTCTTTGAAACTTACATCGTTAGACGTCACGCCCTGCACCTTCGGCGACTCCAAGTCGCAATTGACTGCCG
CAGAATG
GTAGATATTCCTAAAACTCTTTCTTGCACCTCGCATCTGACCATAGCCATAGGTTGCGCACTGCCTACCACGACTTTGCTACCCACGATACCTCCACTGGCCTCGGTGGTGTT
GATGCCTCCATTATGTACGAACTGGAGCGTGACGAGAACACGGGTGCCGGTTTCAACGGCTCTCTTGGCTTCTTCCTGAACTACTACAGCAACAAGGCCTCTATGGCCGACCTTGTTGCC
CTTGGAGCCATCGTCTCCGTGGAAGCGTGCGGGGGCCCAAGAATCCCCTTCCGCGCCGGCCGCATTGACGCTACCGAGGCTGGTCGCATGGGTGTCCCCAAGCCCGATGAGGACATTGAT
ACGCACAAGAAGGAATTTGCTGCTGCCGGTTTTAACGTCAGTGACATGATCGCCGTTGTGGCTTGTGGCCACACGTTTGGTGGCGTTCACGGCAACGATTTCCCTCAAATCACCGGTGTC
GACTCTGAGGATAACTTCCCCAAGTTTGAGAACGGCGACGAATCTGCCCACGTCTTCGACAACAATGTTGTCACGGAATACCTCGATGACAGCACGAGCAACCCGCTGGTTAAGAGCTCT
AACAAGACGTTTATCTCGGACCATCGTGTCTTCAGCTCTGACGGCAATGTAACCATGAAAGCGCTTGCAGACCCCAAGGCTTTCCAGAGCACCTGCAAAGACGTCCTGGCCCGAATGATC
GACACCGTCCCTTCGGCTGTGAAGCTTTCGGACGTTCTTACGCCCCCCGAGATGAAGCCTTATGAGCTTTCCCTCACTTTGACCGAGAAGAACACGCTCCACTTTGAGGGTAAAATCCGT
GTCCGCACGACCGAGATTGGCTCCATGAACGCTCAGGCCGTCACCCTCACGTACACCGACCGCAATGGTAAAACTGCCAGCAACAAGACCATCGAAACCATGCACGGTCGCTACCAGGGT
GGCACGTCCTCGGGCTTCGGCGAGGTGTTCGACTGGTTCGAGATTGACACGGAGCTCCCGATCGACACGTCCATCAGCAAATTCGACATCACTCTCACCAAGCCGGATGGCAAGACTGTC
TACAACAACGCTGGCCACGGCTTCCCTATCCAGGACTCCATTCTCTACGATCAAACCAAGTCTTGCATGTCGCTCCCCGACGCGAACAACAAGAGGACCGTCAAGGTCGTGGCTTACGTG
CGCTCCGAGCGCGCCAACGACCCCGTCAGCTTCAACTTCTACCAGAAAATCGAGAGGCAGGGTGTCATTGTTCCTAAGCTCGACACCTTGAACCAGAAGATGACCAAGGTCGAGGGTAGC
GAGAAGAACGGCTACGTCCAATTCACCGGCGAGGCCGAGGTCAGCCTGGGCCAGTTCGGTACCACCCTCGACGTGCTTGTCGGCGAGGGCGACAACGTCGATATAGTCGACTTCAAGAGG
ACCAACTACCTGACGCAGTGCGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTCTCTCTCTATTGCTGGCGCGAGCCTGCTTTCCCTCCTTCCTGCGTCCGCCGAGTATATTTGGCCGTCTCAGTATGACGAGATTGAAGACGTCTGGAGTCTTCAATCTGGCTAC
GTCCATCACGGTTTCCGCGATA
ACGTCACGCCCTGCACCTTCGGCGACTCCAAGTCGCAATTGACTGCCGCAGAATGGTTGCGCACTGCCTACCACGACTTTGCTACCCACGATACCTCC
ACTGGCCTCGGTGGTGTTGATGCCTCCATTATGTACGAACTGGAGCGTGACGAGAACACGGGTGCCGGTTTCAACGGCTCTCTTGGCTTCTTCCTGAACTACTACAGCAACAAGGCCTCT
ATGGCCGACCTTGTTGCCCTTGGAGCCATCGTCTCCGTGGAAGCGTGCGGGGGCCCAAGAATCCCCTTCCGCGCCGGCCGCATTGACGCTACCGAGGCTGGTCGCATGGGTGTCCCCAAG
CCCGATGAGGACATTGATACGCACAAGAAGGAATTTGCTGCTGCCGGTTTTAACGTCAGTGACATGATCGCCGTTGTGGCTTGTGGCCACACGTTTGGTGGCGTTCACGGCAACGATTTC
CCTCAAATCACCGGTGTCGACTCTGAGGATAACTTCCCCAAGTTTGAGAACGGCGACGAATCTGCCCACGTCTTCGACAACAATGTTGTCACGGAATACCTCGATGACAGCACGAGCAAC
CCGCTGGTTAAGAGCTCTAACAAGACGTTTATCTCGGACCATCGTGTCTTCAGCTCTGACGGCAATGTAACCATGAAAGCGCTTGCAGACCCCAAGGCTTTCCAGAGCACCTGCAAAGAC
GTCCTGGCCCGAATGATCGACACCGTCCCTTCGGCTGTGAAGCTTTCGGACGTTCTTACGCCCCCCGAGATGAAGCCTTATGAGCTTTCCCTCACTTTGACCGAGAAGAACACGCTCCAC
TTTGAGGGTAAAATCCGTGTCCGCACGACCGAGATTGGCTCCATGAACGCTCAGGCCGTCACCCTCACGTACACCGACCGCAATGGTAAAACTGCCAGCAACAAGACCATCGAAACCATG
CACGGTCGCTACCAGGGTGGCACGTCCTCGGGCTTCGGCGAGGTGTTCGACTGGTTCGAGATTGACACGGAGCTCCCGATCGACACGTCCATCAGCAAATTCGACATCACTCTCACCAAG
CCGGATGGCAAGACTGTCTACAACAACGCTGGCCACGGCTTCCCTATCCAGGACTCCATTCTCTACGATCAAACCAAGTCTTGCATGTCGCTCCCCGACGCGAACAACAAGAGGACCGTC
AAGGTCGTGGCTTACGTGCGCTCCGAGCGCGCCAACGACCCCGTCAGCTTCAACTTCTACCAGAAAATCGAGAGGCAGGGTGTCATTGTTCCTAAGCTCGACACCTTGAACCAGAAGATG
ACCAAGGTCGAGGGTAGCGAGAAGAACGGCTACGTCCAATTCACCGGCGAGGCCGAGGTCAGCCTGGGCCAGTTCGGTACCACCCTCGACGTGCTTGTCGGCGAGGGCGACAACGTCGAT
ATAGTCGACTTCAAGAGGACCAACTACCTGACGCAGTGCGCTTAA

Retrieve as FASTA