Entry information : ApruAPx-CcP02
Entry ID 12277
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: ApruAPx-CcP02
Name ApruAPx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Botryosphaeriaceae Aplosporella
Organism Aplosporella prunicola    [TaxId: 462254 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ApruAPx-CcP02
start..stop
S start..stop
GsteAPx-CcP01 854 0 1..763 9..740
GsteAPx-CcP01 194 4e-52 564..763 798..998
GsteAPx-CcP01 115 2e-26 520..658 855..996
GsteAPx-CcP01 100 7e-22 562..661 642..741
TtoAPx-CcP1_CBS112818 735 0 19..763 18..737
TtoAPx-CcP1_CBS112818 96 1e-20 563..661 640..738
TrubrAPx-CcP01 734 0 19..763 18..737
TrubrAPx-CcP01 92 2e-19 563..661 640..738
TrubrAPx-CcP01 84 8e-17 671..764 542..635
MicaAPx-CcP01 733 0 19..763 18..737
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 24534..25652 1119 N° 2 24288..24479 192 N° 3 23705..24239 535 N° 4 23178..23635 458
complement(join(23178..23635,23705..24239,24288..24479,24534..25652))


exon

Literature and cross-references ApruAPx-CcP02
DNA ref. JGI genome:   scaffold_96 (25652..23178)
Cluster/Prediction ref. JGI gene:   313887
Protein sequence: ApruAPx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   768 (747)
PWM (Da):   %s   80787.55 (78329.3) Transmb domain:   %s   i2-24o
PI (pH):   %s   4.15 (4.15) Peptide Signal:   %s   cut: 21 range:21-767
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYWITFVFLVQVLYVGSILAVPIWPTSIDELEDIMFLNTGYRARGFAKAVTPCSAGAGAGRVAAAEFVRTAFHDMANANVYFHTGGLDASIAYETNRLENVGQAFTTTLATYEPFLTSRSSMADIISMGVYTAVRSCGGPVISVRTGRIDAKAAGTSGQVPLPQNAIGIFISQFERIGFNQTEMISLVACGHTLGGVHAGNFPEVVPVGTAADEFAQFDTGDAFDTNVVKEYLSSSTANPLVIGPSTTNGRNSDARVFASDGNVTITAMVDPETFQSVCASMLQRMIDVVPTGVALTDPITPYEVKPNDLRLALISGGDTISFTGEIRVRTTSRSVSSVQLVYKDRDGGNDCGSCLISTELKGNAAGFDDSFAFYGFSAEILSSSSISAFDVELTLSSGETEAFNNGGDSFPVQDEVLLQHSQSCLSTDSSLHVVAAVRNSVSATVNLDLTLKVPASGSVIPVLQAETVTMEKVSTIGPYDLYTASYALDPTFSKSTRFGITAGSSVDSFNSAGDLLSICSDSEPEPPTSSMSTSTSSLISSTTSAISTLVSSSTSQTSSEEVPSPTSTAYSYEGCYTDSVSSRTFNDAVFYDSNMTISKCSEQCTKWAYFGVEYGEECYCGAIFASSSTKASESECNLPCPGNSVEKCGAGDRLSAYKNLLLVDVTNPVIPGYAYQGCYNDSASDRVLVGSSTQADSLTVEGCASFCNAAAYFGVEYGRECYCGSELKASAVKQAEGDCSIMCAGDTAEYCGAADRIGVYRKEGSD

Retrieve as FASTA  
Remarks complete sequence from genomics (3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACTGGATCACTTTCGTTTTCCTGGTCCAAGTATTGTACGTCGGTAGCATATTAGCGGTTCCCATCTGGCCAACTTCCATTGACGAACTGGAGGATATCATGTTCCTCAACACAGGC
TACAGAGCTCGTGGCTTCGCAAAAGCCGTAACACCTTGCTCCGCCGGAGCTGGAGCCGGACGCGTAGCAGCAGCGGAGTTCGTTCGGACGGCCTTCCACGACATGGCGAACGCAAACGTA
TATTTCCACACCGGAGGCCTGGACGCATCAATCGCATATGAAACCAACAGACTTGAAAACGTTGGGCAAGCATTCACTACAACACTCGCAACCTACGAGCCTTTCCTCACTTCAAGATCA
TCGATGGCCGACATCATTTCCATGGGCGTCTATACAGCCGTACGTTCTTGTGGTGGCCCCGTGATTTCTGTCCGAACTGGGAGGATAGATGCCAAAGCCGCGGGCACATCCGGCCAAGTG
CCGCTACCCCAAAACGCGATCGGGATCTTTATAAGCCAGTTCGAACGCATTGGTTTCAACCAGACAGAAATGATTTCTCTTGTCGCCTGCGGGCATACCCTTGGTGGCGTCCATGCTGGC
AACTTTCCGGAAGTTGTACCAGTTGGCACCGCAGCAGATGAGTTTGCACAGTTTGATACCGGCGATGCGTTCGACACGAATGTTGTGAAAGAGTATCTTTCCAGTTCTACAGCCAACCCA
TTAGTTATTGGCCCTTCTACGACAAACGGGCGGAACTCCGATGCGCGCGTCTTTGCGTCAGATGGAAATGTTACCATAACAGCCATGGTGGATCCAGAGACTTTCCAGAGCGTCTGCGCG
TCCATGCTACAGAGAATGATCGATGTCGTGCCGACAGGCGTGGCGCTTACAGATCCAATCACGCCGTACGAAGTCAAGCCAAACGACCTTCGGTTGGCTTTAATTTCTGGAGGCGATACT
ATCTCTTTTACTGGTGAAATCCGTGTCCGGACTACTTCCCGCTCTGTCTCAAGCGTCCAATTAGTGTACAAAGACCGCGACGGAGGCAACGACTGCGGGAGCTGCTTGATCAGTACAGAG
CTTAAGGGCAATGCTGCCGGATTTGACGATAGTTTTGCG
GTATGTAATTGCAAGTCCGTCAGTGAGATCGAATAAGGGTTAATGGTGCAATAGTTTTACGGCTTTTCGGCTGAAATACTT
TCCAGCTCTTCGATATCAGCGTTCGACGTGGAGCTTACACTCTCCAGCGGAGAGACTGAGGCTTTCAACAATGGGGGGGATAGTTTTCCCGTTCAAGACGAGGTTTTACTGCAGCACTCG
CAAAGCTGTCTCAGCACCGACTCTAGCCTGCACGTCGTTGCTGCT
GTGAGTAAGCGTCATTGATAAAGTAGGGCATGAGCTAACAAACAAAAGGTCCGCAACAGTGTTTCTGCCACAGTC
AACTTGGATCTTACTTTGAAAGTTCCAGCTTCCGGCTCGGTCATTCCAGTCCTTCAAGCGGAAACAGTGACGATGGAGAAGGTCTCAACGATCGGACCATACGACCTTTATACTGCTAGT
TACGCCCTGGATCCCACTTTTTCCAAATCCACAAGATTTGGTATAACAGCTGGTTCCAGTGTGGATAGCTTCAACAGCGCAGGAGACCTATTAAGTATTTGTTCTGATTCGGAACCAGAA
CCACCGACTTCGAGCATGTCAACTTCTACATCTTCCCTTATCTCGTCAACAACTTCCGCAATTTCCACTCTTGTGTCATCGAGTACATCGCAAACAAGCTCGGAGGAGGTACCATCTCCG
ACCTCAACAGCCTACTCCTATGAAGGTTGCTACACAGACTCCGTCTCATCACGCACATTCAACGACGCAGTCTTCTACGACAGCAACATGACCATCTCGAAATGCTCAGAACAGTGCACA
AAATGGGCTTACTTCGGTGTCGAGTATG
GTAAGTGGAAGCGCCGGACTTGATTTTGCTCCTAGTCCGACCAAATACTCACAACTGACTTCATTAAAGGCGAGGAATGTTACTGCGGAGCA
ATATTTGCCAGCAGCTCAACCAAGGCCTCCGAAAGTGAATGCAACTTACCCTGCCCTGGGAACAGCGTCGAAAAGTGCGGTGCCGGGGACAGACTAAGTGCTTATAAGAATCTGCTCTTA
GTGGATGTGACGAATCCAGTTATCCCAGGATACGCATACCAGGGTTGTTACAACGACTCGGCTTCGGACAGGGTTCTCGTTGGAAGCTCAACACAGGCTGATTCACTGACGGTGGAAGGC
TGTGCGAGTTTCTGTAATGCAGCGGCATACTTTGGTGTTGAGTACGGACGGGAATGCTATTGTGGCAGTGAGCTAAAGGCGAGCGCGGTCAAGCAGGCAGAGGGGGATTGCTCTATTATG
TGCGCTGGTGATACGGCGGAGTATTGTGGAGCTGCGGACAGGATTGGTGTGTATAGGAAAGAAGGATCAGACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACTGGATCACTTTCGTTTTCCTGGTCCAAGTATTGTACGTCGGTAGCATATTAGCGGTTCCCATCTGGCCAACTTCCATTGACGAACTGGAGGATATCATGTTCCTCAACACAGGC
TACAGAGCTCGTGGCTTCGCAAAAGCCGTAACACCTTGCTCCGCCGGAGCTGGAGCCGGACGCGTAGCAGCAGCGGAGTTCGTTCGGACGGCCTTCCACGACATGGCGAACGCAAACGTA
TATTTCCACACCGGAGGCCTGGACGCATCAATCGCATATGAAACCAACAGACTTGAAAACGTTGGGCAAGCATTCACTACAACACTCGCAACCTACGAGCCTTTCCTCACTTCAAGATCA
TCGATGGCCGACATCATTTCCATGGGCGTCTATACAGCCGTACGTTCTTGTGGTGGCCCCGTGATTTCTGTCCGAACTGGGAGGATAGATGCCAAAGCCGCGGGCACATCCGGCCAAGTG
CCGCTACCCCAAAACGCGATCGGGATCTTTATAAGCCAGTTCGAACGCATTGGTTTCAACCAGACAGAAATGATTTCTCTTGTCGCCTGCGGGCATACCCTTGGTGGCGTCCATGCTGGC
AACTTTCCGGAAGTTGTACCAGTTGGCACCGCAGCAGATGAGTTTGCACAGTTTGATACCGGCGATGCGTTCGACACGAATGTTGTGAAAGAGTATCTTTCCAGTTCTACAGCCAACCCA
TTAGTTATTGGCCCTTCTACGACAAACGGGCGGAACTCCGATGCGCGCGTCTTTGCGTCAGATGGAAATGTTACCATAACAGCCATGGTGGATCCAGAGACTTTCCAGAGCGTCTGCGCG
TCCATGCTACAGAGAATGATCGATGTCGTGCCGACAGGCGTGGCGCTTACAGATCCAATCACGCCGTACGAAGTCAAGCCAAACGACCTTCGGTTGGCTTTAATTTCTGGAGGCGATACT
ATCTCTTTTACTGGTGAAATCCGTGTCCGGACTACTTCCCGCTCTGTCTCAAGCGTCCAATTAGTGTACAAAGACCGCGACGGAGGCAACGACTGCGGGAGCTGCTTGATCAGTACAGAG
CTTAAGGGCAATGCTGCCGGATTTGACGATAGTTTTGCG
TTTTACGGCTTTTCGGCTGAAATACTTTCCAGCTCTTCGATATCAGCGTTCGACGTGGAGCTTACACTCTCCAGCGGAGAG
ACTGAGGCTTTCAACAATGGGGGGGATAGTTTTCCCGTTCAAGACGAGGTTTTACTGCAGCACTCGCAAAGCTGTCTCAGCACCGACTCTAGCCTGCACGTCGTTGCTGCT
GTCCGCAAC
AGTGTTTCTGCCACAGTCAACTTGGATCTTACTTTGAAAGTTCCAGCTTCCGGCTCGGTCATTCCAGTCCTTCAAGCGGAAACAGTGACGATGGAGAAGGTCTCAACGATCGGACCATAC
GACCTTTATACTGCTAGTTACGCCCTGGATCCCACTTTTTCCAAATCCACAAGATTTGGTATAACAGCTGGTTCCAGTGTGGATAGCTTCAACAGCGCAGGAGACCTATTAAGTATTTGT
TCTGATTCGGAACCAGAACCACCGACTTCGAGCATGTCAACTTCTACATCTTCCCTTATCTCGTCAACAACTTCCGCAATTTCCACTCTTGTGTCATCGAGTACATCGCAAACAAGCTCG
GAGGAGGTACCATCTCCGACCTCAACAGCCTACTCCTATGAAGGTTGCTACACAGACTCCGTCTCATCACGCACATTCAACGACGCAGTCTTCTACGACAGCAACATGACCATCTCGAAA
TGCTCAGAACAGTGCACAAAATGGGCTTACTTCGGTGTCGAGTATG
GCGAGGAATGTTACTGCGGAGCAATATTTGCCAGCAGCTCAACCAAGGCCTCCGAAAGTGAATGCAACTTACCC
TGCCCTGGGAACAGCGTCGAAAAGTGCGGTGCCGGGGACAGACTAAGTGCTTATAAGAATCTGCTCTTAGTGGATGTGACGAATCCAGTTATCCCAGGATACGCATACCAGGGTTGTTAC
AACGACTCGGCTTCGGACAGGGTTCTCGTTGGAAGCTCAACACAGGCTGATTCACTGACGGTGGAAGGCTGTGCGAGTTTCTGTAATGCAGCGGCATACTTTGGTGTTGAGTACGGACGG
GAATGCTATTGTGGCAGTGAGCTAAAGGCGAGCGCGGTCAAGCAGGCAGAGGGGGATTGCTCTATTATGTGCGCTGGTGATACGGCGGAGTATTGTGGAGCTGCGGACAGGATTGGTGTG
TATAGGAAAGAAGGATCAGACTGA

Retrieve as FASTA