Entry information : DcryCcP01
Entry ID 12279
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-20 (Catherine Mathe (Scipio))
Peroxidase information: DcryCcP01
Name DcryCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP002]
Taxonomy Eukaryota Fungi Basidiomycota Tremellomycetes Dioszegia
Organism Dioszegia cryoxerica    [TaxId: 603311 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DcryCcP01
start..stop
S start..stop
DcryCcP02 620 0 1..312 1..315
TmesCcP02 532 0 1..312 3..317
CnCcP02_grubiiH99 514 0 1..307 1..312
CnCcP02_JEC21 513 0 1..307 1..312
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 34446..34476 31 N° 2 34533..34608 76 N° 3 34728..34909 182 N° 4 34954..35074 121
N° 5 35105..35174 70 N° 6 35206..35369 164 N° 7 35429..35464 36 N° 8 35518..35627 110
N° 9 35661..35809 149  
join(34446..34476,34533..34608,34728..34909,34954..35074,35105..35174,35206..353 69,35429..35464,35518..35627,35661..35809)


exon

Literature and cross-references DcryCcP01
DNA ref. JGI genome:   scaffold_16 (34446..35809)
Cluster/Prediction ref. JGI gene:   247804
Protein sequence: DcryCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   313
PWM (Da):   %s   34060.14  
PI (pH):   %s   7.32
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAVKEGDFTALRGEIRKILKQPGYDDGSIGPVLVRLAWHASGNFSLVTHNGGSNGAGMRYEPESVDPANAGLHHAISFLIPIQAANPWITHSDLTLAGVEAIEAMGGPKVPWEPGRTDYSSAEEATDHRGDVGNRLPDGAKGADHIREVFGRMGFSDEIVALSGAHSLGRCHPDRSGFDGPWVVNPTRFSNQYYKLLLTKDWKPRQWDGPFQYEATVAGTKLMIQMALIEDPKMRPWVEKYAADKDLFFKDFAMAFGKLELGVERDDSGFARLAKKAAKEGKPLDKTSLPGKGCPFAGTTGRGRDAKL

Retrieve as FASTA  
Remarks complete sequence from genomics (8 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCGTCAAGGAAGGGGACTTTACCGGTGAGACTGACCCGTGTTCCGCCGAATTTGGATGCGGGGTTGGCTGATGATCGCAGCATTGCGAGGCGAGATTCGAAAGATCCTGAAGC
AGCCCGGCTACGATGATGGCTCTATCGGACCAGTACTTGTTCG
GTAAGTGTCTATTCTTGCCAATCAGGTACCACCACTGTAGGGAAGTTCAGAGAAAGGCCTATTGTACCTTTGGAAAC
GGCTGGAGAGAACCACAATTCGATCTATCGCTGACGCTCTAGTCTGGCATGGCACGCCAGTGGCAACTTCTCCCTAGTCACCCACAACGGCGGATCAAACGGGGCTGGCATGCGCTATGA
ACCAGAGTCTGTAGATCCAGCAAATGCAGGCCTACACCACGCCATCTCATTCCTCATCCCTATTCAAGCCGCCAACCCCTGGATAACCCACTCAGACCTATGGA
GTAAGTTCCCCTCCTG
ACAAACTCCCATCGTTGCTAATCAGCAGCACTGGCCGGTGTAGAAGCAATCGAAGCGATGGGCGGCCCCAAAGTCCCCTGGGAGCCCGGAAGGACCGACTATTCCAGCGCCGAAGAGGCG
ACGGACCACCGGGGTGACGTTGGGAATAG
GTATATCGACTTTGGGCGAAGCTGATGTAGATTACCCGACGGAGCCAAGGGCGCTGATCATATCCGAGAGGTCTTTGGCCGGATGGGATTC
AGCGATATG
GTATGTCAGAGTAACACGGAGCTGATTGTAGGAAATCGTCGCGCTATCTGGTGCCCACTCTCTTGGGCGGTGTCATCCCGATCGGTCTGGCTTTGATGGGCCTTGGGTCGT
CAATCCTACGCGATTCAGCAATCAGTACTACAAGCTCTTGTTGACGAAGGACTGGAAGCCTAGACAATGGGATGGGCCATTCCA
GTAAGTGTTACCAAGCTGTCCTGGAGTCGCCTGGTC
CTGGGAGTGAAGCTGACGTCTAGATACGAGGCCACCGTCGCTGGAACTAAGCTTATGATGTTATCTACAGACGCTCGTCTATCGCATCATTGGCATCTACCAAGCTGATCAGACAGATGG
CTCTCATCGAGGATCCCAAAATGAGACCTTGGGTAGAGAAATACGCCGCGGACAAAGATCTCTTCTTTAAGGACTTCGCCATGGCGTTCGGCAAGCTCATCG
GTACGTCCTACGTTATGC
AAAGCTGACATCCAGAGCTAGGAGTAGAACGGGATGACTCTGGCTTTGCGCGATTAGCAAAGAAGGCGGCAAAGGAGGGCAAGCCGCTCGACAAGACGTCTTTGCCCGGGAAGGGGTGTC
CATTTGCTGGAACCACTGGACGTGGTAGAGATGCGAAGCTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCGTCAAGGAAGGGGACTTTACCGCATTGCGAGGCGAGATTCGAAAGATCCTGAAGCAGCCCGGCTACGATGATGGCTCTATCGGACCAGTACTTGTTCGTCTGGCATGGCAC
GCCAGTGGCAACTTCTCCCTAGTCACCCACAACGGCGGATCAAACGGGGCTGGCATGCGCTATGAACCAGAGTCTGTAGATCCAGCAAATGCAGGCCTACACCACGCCATCTCATTCCTC
ATCCCTATTCAAGCCGCCAACCCCTGGATAACCCACTCAGACCTATGGA
CACTGGCCGGTGTAGAAGCAATCGAAGCGATGGGCGGCCCCAAAGTCCCCTGGGAGCCCGGAAGGACCGAC
TATTCCAGCGCCGAAGAGGCGACGGACCACCGGGGTGACGTTGGGAATAG
ATTACCCGACGGAGCCAAGGGCGCTGATCATATCCGAGAGGTCTTTGGCCGGATGGGATTCAGCGATATG
GAAATCGTCGCGCTATCTGGTGCCCACTCTCTTGGGCGGTGTCATCCCGATCGGTCTGGCTTTGATGGGCCTTGGGTCGTCAATCCTACGCGATTCAGCAATCAGTACTACAAGCTCTTG
TTGACGAAGGACTGGAAGCCTAGACAATGGGATGGGCCATTCCA
ATACGAGGCCACCGTCGCTGGAACTAAGCTTATGATACAGATGGCTCTCATCGAGGATCCCAAAATGAGACCTTGG
GTAGAGAAATACGCCGCGGACAAAGATCTCTTCTTTAAGGACTTCGCCATGGCGTTCGGCAAGCTCATCG
AGCTAGGAGTAGAACGGGATGACTCTGGCTTTGCGCGATTAGCAAAGAAG
GCGGCAAAGGAGGGCAAGCCGCTCGACAAGACGTCTTTGCCCGGGAAGGGGTGTCCATTTGCTGGAACCACTGGACGTGGTAGAGATGCGAAGCTGTAG

Retrieve as FASTA