Entry information : DcryCcP02
Entry ID 12280
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-20 (Catherine Mathe (Scipio))
Peroxidase information: DcryCcP02
Name DcryCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP002]
Taxonomy Eukaryota Fungi Basidiomycota Tremellomycetes Dioszegia
Organism Dioszegia cryoxerica    [TaxId: 603311 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DcryCcP02
start..stop
S start..stop
DcryCcP01 620 0 1..315 1..312
TmesCcP02 539 0 1..315 3..317
CnCcP02_grubiiH99 521 0 1..310 1..312
CnCcP02_JEC21 518 0 1..310 1..312
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7700..7730 31 N° 2 7796..7871 76 N° 3 8004..8185 182 N° 4 8229..8349 121
N° 5 8380..8449 70 N° 6 8481..8644 164 N° 7 8693..8847 155 N° 8 8895..9043 149
join(7700..7730,7796..7871,8004..8185,8229..8349,8380..8449,8481..8644,8693..884 7,8895..9043)


exon

Literature and cross-references DcryCcP02
DNA ref. JGI genome:   scaffold_252 (7700..9043)
Cluster/Prediction ref. JGI gene:   313726
Protein sequence: DcryCcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316
PWM (Da):   %s   34427.28  
PI (pH):   %s   7.32
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAVKEGDFTALRSEIRKILKQPGYDDGSIGPVLVRLAWHASGNFSLVTHNGGSNGAGMRYEPESTDPANAGLHHAISFLIPIQAANPWITHSDLTLAGVEAIEAMGGPKVPWEPGRTDYSSAEEATDHRGDVGNRLPDGAKGADHIREVFGRMGFSDEIVALSGAHSLGRCHPDRSGFDGPWVVNPTRFSNQYYKLLLSQKWKPREWDGPFQYEATVAGTKLMMLVSDYALIQDPKMRPWVEKYAADKDLFFKDFAMAFGKLELGVERDDSGFARLAKKAAKEGKPLDKTSLPGKGCPFAGTTGRGRDAKL

Retrieve as FASTA  
Remarks complete sequence from genomics (7 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCGTCAAAGAAGGGGACTTTACCGGTTCGTTCAAGCGATCTTGGCCGATTCCTGTTAGGGGAGTCAGGAGTTCAACTGATAAAGTTCAGCGTTGCGAAGCGAGATTCGCAAGA
TCTTGAAACAACCAGGCTATGATGATGGTTCCATTGGCCCAGTACTAGTCCG
GTGAGTGTCTGGTTCTGCTAGTCAAGTACCACCGTGTGTAGGGACGATCAAAGCAAAGCATCTGATCC
TTCAAACACGGTTGTAAAGGGGCGATCGTCCTCCCGCCACCTTGATCTATAGCTGACGTTCTAGTCTGGCATGGCACGCCAGCGGCAACTTCTCTCTAGTCACTCACAACGGCGGATCTA
ACGGCGCCGGAATGAGATACGAACCAGAGAGCACAGATCCTGCCAATGCGGGTCTACACCATGCCATCTCATTCCTCATCCCCATCCAAGCCGCCAACCCCTGGATAACCCACTCAGACC
TGTGGA
GTGAGTATCTTCCATACCCGAGCCTCACCATGCTGACTAGCAGCACTCGCCGGTGTAGAAGCGATCGAAGCGATGGGCGGGCCCAAAGTCCCATGGGAGCCCGGAAGGACCGAC
TATTCCAGCGCAGAAGAGGCGACGGACCACCGGGGGGACGTTGGAAATAG
GTATGTCGACTTTGGGCGAAGCTAATGTAGATTACCTGATGGTGCCAAAGGCGCAGACCATATCCGAGAG
GTTTTTGGAAGGATGGGCTTTAGCGATATG
GTGGGTCTAAGAAAGGCTAGGCTGATGTCAGGAAATCGTGGCGCTCTCAGGTGCCCACTCTTTGGGCAGGTGTCATCCCGATCGGTCTGG
CTTTGATGGGCCTTGGGTCGTCAACCCTACTCGCTTCAGCAATCAGTATTACAAGCTGTTATTGAGCCAGAAGTGGAAGCCTAGGGAGTGGGATGGACCGTTCCA
GTGAGTCAATCTTCT
TTTGTGGCGGGTCTGGACATTGCTGATATACAGATATGAAGCAACCGTGGCTGGCACAAAGCTTATGATGTTGGTATCTGACTATGCGTTGATACAGGATCCCAAGATGAGACCATGGGT
GGAGAAGTACGCAGCGGACAAGGACCTCTTCTTCAAGGACTTTGCCATGGCGTTCGGCAAGCTCATTG
GTGAGTCTTACATCCCCAGTCTCACATCCTACAGAGCTGATGTTCAGAGCTG
GGAGTGGAGAGGGACGACTCTGGCTTTGCTCGATTAGCAAAGAAGGCGGCAAAGGAGGGCAAGCCGCTCGACAAGACTTCTCTGCCTGGGAAGGGTTGTCCGTTTGCCGGGACCACTGGA
CGAGGACGAGACGCCAAGTTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCGTCAAAGAAGGGGACTTTACCGCGTTGCGAAGCGAGATTCGCAAGATCTTGAAACAACCAGGCTATGATGATGGTTCCATTGGCCCAGTACTAGTCCGTCTGGCATGGCAC
GCCAGCGGCAACTTCTCTCTAGTCACTCACAACGGCGGATCTAACGGCGCCGGAATGAGATACGAACCAGAGAGCACAGATCCTGCCAATGCGGGTCTACACCATGCCATCTCATTCCTC
ATCCCCATCCAAGCCGCCAACCCCTGGATAACCCACTCAGACCTGTGGA
CACTCGCCGGTGTAGAAGCGATCGAAGCGATGGGCGGGCCCAAAGTCCCATGGGAGCCCGGAAGGACCGAC
TATTCCAGCGCAGAAGAGGCGACGGACCACCGGGGGGACGTTGGAAATAG
ATTACCTGATGGTGCCAAAGGCGCAGACCATATCCGAGAGGTTTTTGGAAGGATGGGCTTTAGCGATATG
GAAATCGTGGCGCTCTCAGGTGCCCACTCTTTGGGCAGGTGTCATCCCGATCGGTCTGGCTTTGATGGGCCTTGGGTCGTCAACCCTACTCGCTTCAGCAATCAGTATTACAAGCTGTTA
TTGAGCCAGAAGTGGAAGCCTAGGGAGTGGGATGGACCGTTCCA
ATATGAAGCAACCGTGGCTGGCACAAAGCTTATGATGTTGGTATCTGACTATGCGTTGATACAGGATCCCAAGATG
AGACCATGGGTGGAGAAGTACGCAGCGGACAAGGACCTCTTCTTCAAGGACTTTGCCATGGCGTTCGGCAAGCTCATTG
AGCTGGGAGTGGAGAGGGACGACTCTGGCTTTGCTCGATTA
GCAAAGAAGGCGGCAAAGGAGGGCAAGCCGCTCGACAAGACTTCTCTGCCTGGGAAGGGTTGTCCGTTTGCCGGGACCACTGGACGAGGACGAGACGCCAAGTTGTAG

Retrieve as FASTA