Entry information : ParcCIIBA01
Entry ID 12293
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2018-01-17 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-01-17 (Catherine Mathe)
Peroxidase information: ParcCIIBA01
Name ParcCIIBA01
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Polyporaceae Polyporus
Organism Polyporus arcularius    [TaxId: 5639 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ParcCIIBA01
start..stop
S start..stop
DsCIIBA05 593 0 1..361 1..364
GsppCIIBA06 560 0 14..361 15..358
TvCIIBA11 525 0 1..361 1..362
ParcCIIBA02 523 0 20..361 20..363
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20966..21073 108 N° 2 21127..21170 44 N° 3 21222..21267 46 N° 4 21329..21522 194
N° 5 21584..21815 232 N° 6 21874..21936 63 N° 7 21997..22141 145 N° 8 22200..22415 216
N° 9 22481..22518 38  
join(20966..21073,21127..21170,21222..21267,21329..21522,21584..21815,21874..219 36,21997..22141,22200..22415,22481..22518)


exon

Literature and cross-references ParcCIIBA01
DNA ref. JGI genome:   scaffold_264 (20966..2251)
Cluster/Prediction ref. JGI gene:   600763
Protein sequence: ParcCIIBA01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (343)
PWM (Da):   %s   38406.17 (36507.0)  
PI (pH):   %s   4.97 (4.88) Peptide Signal:   %s   cut: 19 range:19-361
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFTKTLVAILGLALIVGAVPPKKATCSKGRKASDQRCCVWFDVLDDIQENLFDGGECGEEVHESLRLTFHDAISFSPKMFREGKFGGGGADGSIMAFAEVETHFDASVGLDEIVGEQKPFALAHKVSFGDFIQFAGAVGVSNCVGGPHLQFLAGRSNHSQVSPDGLIPLPTDSVDTILARFADAGFSASEVVDLLASHTVAAQDHIDPDIHGSPFDSTPSEFDAQFFVETLLKGVAFPGNGSHSGEVLSPYPGELRLQSDALLARDPRTACEWQSFISNHDLMVQRFTKAMAKMAVLGNDPRTLYDCSEVIPVPKPAASKVAHLPAGKTLKDIEHACKATPFPTIKADPGPETSIPVVPAS*

Retrieve as FASTA  
Remarks complete sequence from genomics (8 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCACCAAGACTCTGGTCGCTATTCTCGGTCTCGCCTTGATTGTGGGTGCCGTCCCTCCCAAGAAGGCGACGTGCAGCAAGGGTCGTAAGGCCAGTGATCAAAGGGTGAGCTTTCAG
CGCGAAAGCTTCAGGTAACACGCTCACCGTGCCTCTTGCAGTGTTGCGTTTGGTTCGATGTCCTCGATGACATTCAGGAGAACCTGTGAGCCTTTCGAGTCTCTCCCCTGTAGATCGAGT
ACTGATATGCCTCTAGATTCGATGGCGGAGAGTGTGGTGAAGAAGTCCACGAGTCGCTCCGCGTAGGTTTACACCACCTCAACCGCATCGTACCGCATATACCGAACTACCTCTTATTTG
CAGTTGACCTTCCACGACGCCATCAGCTTTTCTCCGAAGATGTTCAGGGAGGGCAAGTTCGGCGGCGGCGGCGCTGACGGATCCATCATGGCGTTCGCAGAAGTAGAGACGCACTTCGAC
GCAAGTGTCGGTCTCGACGAGATTGTCGGCGAGCAGAAGCCCTTCGCGCTTGCGCACAAGGTCTCCTTCGGCGACTT
GTACGTCTCATCGTCACTAGCCTACTCACTCTCGCTCAGAGAC
TCATCCGTGACACTTCAGCATTCAGTTCGCCGGCGCCGTCGGTGTGAGCAACTGCGTTGGCGGCCCTCACCTGCAATTCCTGGCCGGCCGTTCCAACCACTCGCAGGTCTCCCCCGACGG
CCTGATCCCTCTGCCTACGGACTCTGTCGACACCATCCTTGCTCGCTTCGCCGATGCCGGCTTCTCCGCCTCCGAGGTCGTCGACCTCCTCGCCTCGCACACCGTCGCTGCTCAGGACCA
CATCGACCCC
GTGAGTCGAGCTCTCTGCTTTTCAGACGCGCCGTTGTTGACTTCGAGACATCGACCAGGACATCCACGGCAGCCCCTTCGACTCAACCCCCTCCGAGTTCGATGCGCAAT
TCTTCGTTGAG
GTCGGTGCACGTCCACATGGTGATGTGATGCCCTGTGACTGAAGTCATCGACCCATCTAGACTCTCCTCAAGGGTGTTGCTTTCCCTGGGAACGGCTCTCACTCCGGCG
AAGTCCTGTCCCCCTACCCCGGCGAGCTTCGCCTCCAGTCCGACGCTCTCCTCGCCCGCGACCCACGCACCGCCTGCGAGTGGCAGTCCTTCATCT
GTACGCCCCTTCTTTCTGTGCGCG
CCGGCCTAAACGCCTGACCCTCACTCTCTCCCAGCGAACCACGATCTGATGGTCCAGCGGTTCACCAAGGCAATGGCCAAGATGGCTGTGCTCGGCAACGACCCCCGCACGCTCTACGAC
TGCTCGGAGGTCATCCCCGTCCCGAAGCCCGCCGCGTCCAAGGTCGCGCACCTCCCCGCCGGCAAGACGCTCAAGGACATCGAACATGCGTGCAAGGCGACGCCCTTCCCCACCATCAAG
GCTGACCCTG
GTGTGTATCCGCTCATAACCTCTATTGAAGCGTGGGGACTGGCTGACGATGTGTGCGCGCGTCAGGCCCGGAGACCTCCATCCCCGTCGTTCCGGCCTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCACCAAGACTCTGGTCGCTATTCTCGGTCTCGCCTTGATTGTGGGTGCCGTCCCTCCCAAGAAGGCGACGTGCAGCAAGGGTCGTAAGGCCAGTGATCAAAGGTGTTGCGTTTGG
TTCGATGTCCTCGATGACATTCAGGAGAACCT
ATTCGATGGCGGAGAGTGTGGTGAAGAAGTCCACGAGTCGCTCCGCTTGACCTTCCACGACGCCATCAGCTTTTCTCCGAAGATGTTC
AGGGAGGGCAAGTTCGGCGGCGGCGGCGCTGACGGATCCATCATGGCGTTCGCAGAAGTAGAGACGCACTTCGACGCAAGTGTCGGTCTCGACGAGATTGTCGGCGAGCAGAAGCCCTTC
GCGCTTGCGCACAAGGTCTCCTTCGGCGACTT
CATTCAGTTCGCCGGCGCCGTCGGTGTGAGCAACTGCGTTGGCGGCCCTCACCTGCAATTCCTGGCCGGCCGTTCCAACCACTCGCAG
GTCTCCCCCGACGGCCTGATCCCTCTGCCTACGGACTCTGTCGACACCATCCTTGCTCGCTTCGCCGATGCCGGCTTCTCCGCCTCCGAGGTCGTCGACCTCCTCGCCTCGCACACCGTC
GCTGCTCAGGACCACATCGACCCC
GACATCCACGGCAGCCCCTTCGACTCAACCCCCTCCGAGTTCGATGCGCAATTCTTCGTTGAGACTCTCCTCAAGGGTGTTGCTTTCCCTGGGAAC
GGCTCTCACTCCGGCGAAGTCCTGTCCCCCTACCCCGGCGAGCTTCGCCTCCAGTCCGACGCTCTCCTCGCCCGCGACCCACGCACCGCCTGCGAGTGGCAGTCCTTCATCT
CGAACCAC
GATCTGATGGTCCAGCGGTTCACCAAGGCAATGGCCAAGATGGCTGTGCTCGGCAACGACCCCCGCACGCTCTACGACTGCTCGGAGGTCATCCCCGTCCCGAAGCCCGCCGCGTCCAAG
GTCGCGCACCTCCCCGCCGGCAAGACGCTCAAGGACATCGAACATGCGTGCAAGGCGACGCCCTTCCCCACCATCAAGGCTGACCCTG
GCCCGGAGACCTCCATCCCCGTCGTTCCGGCC
TCGTAA

Retrieve as FASTA