Entry information : ParcCIIBA06
Entry ID 12295
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2018-01-18 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-01-18 (Catherine Mathe)
Peroxidase information: ParcCIIBA06
Name ParcCIIBA06
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Polyporaceae Polyporus
Organism Polyporus arcularius    [TaxId: 5639 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ParcCIIBA06
start..stop
S start..stop
GsppCIIBA09 604 0 1..361 1..361
GsppCIIBA08 604 0 1..361 1..361
DsCIIBA04 584 0 1..361 1..361
ParcCIIBA04 575 0 23..358 26..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37656..37763 108 N° 2 37560..37603 44 N° 3 37472..37508 37 N° 4 37407..37415 9
N° 5 37294..37352 59 N° 6 37185..37240 56 N° 7 37055..37133 79 N° 8 36756..36996 241
N° 9 36494..36692 199 N° 10 36252..36427 176 N° 11 36118..36182 65 N° 12 36052..36064 13
complement(join(36052..36064,36118..36182,36252..36427,36494..36692,36756..36996 ,37055..37133,37185..37240,37294..37352,37407..37415,37472..37508,37560..37603,3 7656..37763))


exon

Literature and cross-references ParcCIIBA06
DNA ref. JGI genome:   scaffold_316 (37763..36052)
Cluster/Prediction ref. JGI gene:   204331
Protein sequence: ParcCIIBA06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (343)
PWM (Da):   %s   38082.03 (36197.9)  
PI (pH):   %s   4.58 (4.47) Peptide Signal:   %s   cut: 19 range:19-361
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFAKAILALAALAVTIKAAPSPEAVCSQGRRASSAACCVWFDVLDDIQENLFDGGECGEEAHESLRLTFHDAIGFSPKLFREGKFGGGGADGSIIAFSEIETNFHANDGVDEIVEEQRPFAIKHKVSFGDFIQFAGAVGVSNCAGGPRLQFLAGRSNISQPSPDLLVPEPSDSNDVIFARMGDAGFSPNEIVDLLASHSVAAQDRVDPTIPGTPFDSTPSTFDTQFFVETLLKGTLFPGNGSNTGELLSPLGGEFRLFSDANIARDARTACEWQSFVNNHASMVSKFEKVMVKLATLGQNPRALTDCSEVIPVPKNVRLPPPTLPAGKTLKDVEAACRATPFPAISAAPGPATTVAPVPPS*

Retrieve as FASTA  
Remarks complete sequence from genomics (11 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCCAAGGCCATTCTCGCTCTTGCCGCGCTTGCGGTCACTATCAAGGCTGCTCCCTCTCCCGAGGCTGTCTGCAGTCAGGGTCGCCGTGCTAGCAGTGCTGCTGTGAGTATTACC
GTTGTATCTGCGTCCCTGCCGATGCTGATGTCGTTTCTAGTGCTGTGTCTGGTTCGATGTCCTCGACGACATCCAGGAGAACCTGTACGAGGTGCCGCTTGCAAGTGAGGTGTGCGTGTA
CTAATGTTTCCATAGGTTCGACGGCGGCGAGTGCGGTGAGGAAGCGCACGAGGTGAGCTGCCTGAATTTGGGCTTCTTTGCGCGTATGTGCTGACCATGCGTTTGCAGTCCCTCCGTGTG
AGTAGCGAACCGTAGCTCGTACCGTGCAGCTTGAACTGAGTTGTGGGGCAGTTGACCTTCCACGACGCTATCGGCTTCTCGCCCAAGCTCTTCCGCGAGGGCAAGTTCGGGTATGTAGCA
TGCCGTCCTCGAATACGTTCCACCTCTGACGTGGTCCTCACAGCGGTGGAGGCGCCGACGGCTCCATCATTGCCTTCTCCGAGATCGAGACCAACTTCCGTACGTGCACATCTCGTGGTG
TCGGCTTGCAATGTCCTGACTGTCTTCCAGACGCCAACGATGGTGTGGACGAGATCGTCGAGGAACAGCGTCCCTTCGCCATCAAGCACAAGGTCTCCTTCGGCGACTTGTGGGTGCTGC
TCCTATCGCTCTTCCGTTCGCATTCTAACGGGATATACTATATACAGCATCCAGTTCGCGGGCGCCGTCGGCGTCTCGAACTGCGCTGGTGGCCCTCGCCTCCAGTTCCTCGCTGGTCGC
TCCAACATCTCGCAGCCGTCGCCCGATCTGCTCGTTCCTGAGCCCTCCGACTCCAACGATGTGATCTTCGCCCGTATGGGCGATGCCGGCTTCTCGCCCAACGAGATCGTCGACCTCCTC
GCATCCCACTCCGTCGCCGCTCAGGACCGCGTCGACCCCACCATCCCC
GTAAGCTCCCTCTGTCTCCCCTCGTAGTACCAGCGGTGTTGCTCACCCCCAATACCCTCGCAGGGCACGCCG
TTCGACTCGACCCCGAGCACCTTCGACACCCAGTTCTTCGTCGAGACCCTGCTCAAGGGCACTCTCTTCCCCGGCAACGGCTCCAACACCGGCGAGCTCCTGTCCCCTCTCGGCGGCGAA
TTCCGTCTGTTCTCGGATGCTAACATCGCCCGCGACGCGCGCACCGCTTGCGAGTGGCAGTCGTTCGTCA
GTACGTACCTCTCGCGCGCCATTCTCCGGGACTCAACTTGACTCACGGCT
CATTCGTCCCACACAGACAACCACGCGAGCATGGTGTCCAAGTTCGAGAAGGTCATGGTCAAGCTCGCGACCCTCGGCCAGAACCCGCGTGCGCTCACCGACTGCTCCGAGGTCATCCCC
GTCCCCAAGAACGTCAGGCTTCCGCCCCCGACTCTCCCGGCTGGCAAGACGCTTAAGGACGTTGAGGCTGCG
GTACGTGACTCTACAACTGCGGATGCACGCTGCCAGGTGTGCTGACTA
CACTTTCGTCTGTCCGGACAGTGCCGCGCGACTCCCTTCCCCGCCATCAGTGCCGCGCCCGGCCCCGCGACCACCGTCGCTCCCGTGTACGTTCATCTTTGTCGTCTGAGTCTGAAGCAT
AGCTGACTTCGTCCTACAGCCCTCCCTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCCAAGGCCATTCTCGCTCTTGCCGCGCTTGCGGTCACTATCAAGGCTGCTCCCTCTCCCGAGGCTGTCTGCAGTCAGGGTCGCCGTGCTAGCAGTGCTGCTTGCTGTGTCTGG
TTCGATGTCCTCGACGACATCCAGGAGAACCT
GTTCGACGGCGGCGAGTGCGGTGAGGAAGCGCACGAGTCCCTCCGTTTGACCTTCCACGACGCTATCGGCTTCTCGCCCAAGCTCTTC
CGCGAGGGCAAGTTCGG
CGGTGGAGGCGCCGACGGCTCCATCATTGCCTTCTCCGAGATCGAGACCAACTTCCACGCCAACGATGGTGTGGACGAGATCGTCGAGGAACAGCGTCCCTTC
GCCATCAAGCACAAGGTCTCCTTCGGCGACTT
CATCCAGTTCGCGGGCGCCGTCGGCGTCTCGAACTGCGCTGGTGGCCCTCGCCTCCAGTTCCTCGCTGGTCGCTCCAACATCTCGCAG
CCGTCGCCCGATCTGCTCGTTCCTGAGCCCTCCGACTCCAACGATGTGATCTTCGCCCGTATGGGCGATGCCGGCTTCTCGCCCAACGAGATCGTCGACCTCCTCGCATCCCACTCCGTC
GCCGCTCAGGACCGCGTCGACCCCACCATCCCC
GGCACGCCGTTCGACTCGACCCCGAGCACCTTCGACACCCAGTTCTTCGTCGAGACCCTGCTCAAGGGCACTCTCTTCCCCGGCAAC
GGCTCCAACACCGGCGAGCTCCTGTCCCCTCTCGGCGGCGAATTCCGTCTGTTCTCGGATGCTAACATCGCCCGCGACGCGCGCACCGCTTGCGAGTGGCAGTCGTTCGTCA
ACAACCAC
GCGAGCATGGTGTCCAAGTTCGAGAAGGTCATGGTCAAGCTCGCGACCCTCGGCCAGAACCCGCGTGCGCTCACCGACTGCTCCGAGGTCATCCCCGTCCCCAAGAACGTCAGGCTTCCG
CCCCCGACTCTCCCGGCTGGCAAGACGCTTAAGGACGTTGAGGCTGCG
TGCCGCGCGACTCCCTTCCCCGCCATCAGTGCCGCGCCCGGCCCCGCGACCACCGTCGCTCCCGTCCCTCCC
TCTTAA

Retrieve as FASTA