Entry information : ParcCIIBA02
Entry ID 12297
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2018-01-17 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-01-18 (Catherine Mathe)
Peroxidase information: ParcCIIBA02
Name ParcCIIBA02
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Polyporaceae Polyporus
Organism Polyporus arcularius    [TaxId: 5639 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ParcCIIBA02
start..stop
S start..stop
DsCIIBA05 542 0 1..363 1..364
ParcCIIBA01 539 0 1..363 1..361
GsppCIIBA06 538 0 15..363 16..358
TvCIIBA11 504 0 1..363 1..362
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 71568..71675 108 N° 2 71460..71509 50 N° 3 71387..71406 20 N° 4 71298..71323 26
N° 5 71183..71241 59 N° 6 71115..71128 14 N° 7 70938..71058 121 N° 8 70652..70883 232
N° 9 70538..70600 63 N° 10 70370..70476 107 N° 11 70272..70309 38 N° 12 69995..70210 216
N° 13 69911..69935 25 N° 14 69845..69857 13  
complement(join(69845..69857,69911..69935,69995..70210,70272..70309,70370..70476 ,70538..70600,70652..70883,70938..71058,71115..71128,71183..71241,71298..71323,7 1387..71406,71460..71509,71568..71675))


exon

Literature and cross-references ParcCIIBA02
DNA ref. JGI genome:   scaffold_5 (71675..69845)
Cluster/Prediction ref. JGI gene:   509237
Protein sequence: ParcCIIBA02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   363 (345)
PWM (Da):   %s   37662.57 (35835.5)  
PI (pH):   %s   4.24 (4.20) Peptide Signal:   %s   cut: 19 range:19-363
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVSKGLLSLLALSAVVSAAPSKRAACSNGRAANDERCCIWFDVLDDINSDGGLFDGGECGEEAHESLRLTFHDAISISNELIKEGQFGGGGADGSIMAFADIETNFKASVGLDEIVEEQRPIALRHNVSFGDFIQFAGAVAVSNCAGGPRLQFLAGRSNDSQVSPDGLIPLPTDSVDKILARMADAGFSAAETVDLLASHSVAAQDHIDPSIHGSPFDSTPSSFDAQFYVETLLKGTLFPGNGSNPGEVESALAGELRLQSDAAIARDPRTACEWQSFVTDQASMVAKFTAAMAKMAVLGQDPKTLVDCSEVIPVPAKALTQVAHLPAGKNLADIEAACQATPFPTISADPGPATTVAPVPPS*

Retrieve as FASTA  
Remarks complete sequence from genomics (13 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCCAAGGGTTTGTTGTCTTTGCTTGCGCTCTCCGCGGTCGTCAGTGCGGCTCCCTCGAAGAGGGCTGCGTGCAGTAATGGCAGGGCAGCTAACGATGAGAGGGTGGGCTTGCTC
AGCATCACTATTATGATCGTTGGCGAGTCTTGATCCTCATTCACAGTGTTGCATCTGGTTCGATGTCCTCGACGACATCAATAGCGATGGTGGACTGTGAGTAGGACGTCCATGGGACTT
TGTACCGTTTCGCTCACTGTTGCACTCAGCTTCGATGGTGGGGAATGTGGTGAGTAGACCCGCTCCTGACCTATATATGCCACTTAAGTTGCACTCATGCTTCCTGTTCTAGGCGAGGAG
GCCCACGAGTCGCTCCGT
GTATGTTGCGACCTATCGTCATGCACCTGCTCGAATTAACATCAGCGCATACACAGCTGACGTTCCACGACGCAATCAGCATTTCTAATGAGTTGATCAAGG
AAGGCCAGTTTGG
GTAAGCATTGAATGTGCACTTTACCATGTCCGTGGTACTGATGCTGGCTTATAGCGGCGGCGGCGCTGGTAAGTTTCAACACCCATACAGTGTGAGCAAGGATGCGC
GGCTTATTGTTACCAAGACGGCTCTATCATGGCATTCGCCGACATTGAGACCAACTTCAAGGCGAGCGTCGGTCTTGACGAGATCGTCGAAGAGCAGCGTCCGATCGCGCTCCGCCACAA
TGTTTCCTTCGGTGATTT
GTACGAAATCTGGCCTCTCGCGCACCTATTAGCCCGTTGACGTACCCATCTTAGCATCCAATTTGCGGGCGCCGTGGCAGTGAGCAATTGTGCCGGCGGCCC
TCGCCTGCAGTTCCTTGCTGGCCGGTCAAATGACTCGCAGGTTTCTCCCGACGGCTTGATCCCCCTGCCGACTGACTCCGTCGACAAGATCCTGGCACGGATGGCCGACGCTGGCTTCAG
CGCGGCAGAGACTGTGGACCTCCTCGCGTCCCATAGTGTCGCTGCACAGGATCACATCGACCCG
GTGAGGTCACACGGTCTGTCCACCCTTCGATCATTTACACCTACTCCTTAGAGCAT
CCACGGGAGCCCATTCGACTCAACGCCGTCTAGCTTCGATGCTCAATTCTATGTCGAG
GTGTGCTGATTCTGGAGTGGTGATCGCAAGAAGAGGAACCTTCTCACCTTCCCACCTTCAGA
CTCTCCTCAAGGGTACTCTGTTCCCTGGCAATGGATCCAACCCCGGCGAAGTCGAGTCTGCCCTGGCTGGGGAGCTCAGACTCCAGTCCGACGCCGCCATCGCCAG
GTCAGTCGGTGCAT
ACTGCTGGACGTCTTCAGACGTAGCTGACCCGACCCGTCATCACAGGGACCCCCGTACTGCATGCGAATGGCAGTCCTTCGTCAGTGAGTACCCCTTGACGTGCACATCCACATCCACAT
CCACATCTCAACCCGCACCCCACAGCCGATCAAGCCTCCATGGTCGCTAAGTTCACCGCCGCCATGGCCAAGATGGCAGTTCTCGGCCAGGACCCGAAGACCTTAGTTGACTGCTCCGAG
GTCATCCCCGTCCCTGCCAAGGCTCTAACACAGGTCGCCCACTTGCCCGCGGGCAAGAATCTCGCCGACATCGAGGCCGCCTGCCAGGCCACTCCGTTCCCTACGATTAGTGCTGATCCT
G
GTCCGTTGTTCTCAATGGTGTGTCTGTTGCGCGGACTAACGAGGTTTCGCTATCGACAGGTCCGGCAACCACTGTGGCCCCCGTGTAAGTCCCTGCACTAGACAGTATGCTGGCCGATG
CTGATTATAAGTTTGTAGCCCTCCTTCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCCAAGGGTTTGTTGTCTTTGCTTGCGCTCTCCGCGGTCGTCAGTGCGGCTCCCTCGAAGAGGGCTGCGTGCAGTAATGGCAGGGCAGCTAACGATGAGAGGTGTTGCATCTGG
TTCGATGTCCTCGACGACATCAATAGCGATGGTGGACT
CTTCGATGGTGGGGAATGTGGCGAGGAGGCCCACGAGTCGCTCCGTCTGACGTTCCACGACGCAATCAGCATTTCTAATGAG
TTGATCAAGGAAGGCCAGTTTGG
CGGCGGCGGCGCTGACGGCTCTATCATGGCATTCGCCGACATTGAGACCAACTTCAAGGCGAGCGTCGGTCTTGACGAGATCGTCGAAGAGCAGCGT
CCGATCGCGCTCCGCCACAATGTTTCCTTCGGTGATTT
CATCCAATTTGCGGGCGCCGTGGCAGTGAGCAATTGTGCCGGCGGCCCTCGCCTGCAGTTCCTTGCTGGCCGGTCAAATGAC
TCGCAGGTTTCTCCCGACGGCTTGATCCCCCTGCCGACTGACTCCGTCGACAAGATCCTGGCACGGATGGCCGACGCTGGCTTCAGCGCGGCAGAGACTGTGGACCTCCTCGCGTCCCAT
AGTGTCGCTGCACAGGATCACATCGACCCG
AGCATCCACGGGAGCCCATTCGACTCAACGCCGTCTAGCTTCGATGCTCAATTCTATGTCGAGACTCTCCTCAAGGGTACTCTGTTCCCT
GGCAATGGATCCAACCCCGGCGAAGTCGAGTCTGCCCTGGCTGGGGAGCTCAGACTCCAGTCCGACGCCGCCATCGCCAG
GGACCCCCGTACTGCATGCGAATGGCAGTCCTTCGTCACC
GATCAAGCCTCCATGGTCGCTAAGTTCACCGCCGCCATGGCCAAGATGGCAGTTCTCGGCCAGGACCCGAAGACCTTAGTTGACTGCTCCGAGGTCATCCCCGTCCCTGCCAAGGCTCTA
ACACAGGTCGCCCACTTGCCCGCGGGCAAGAATCTCGCCGACATCGAGGCCGCCTGCCAGGCCACTCCGTTCCCTACGATTAGTGCTGATCCTG
GTCCGGCAACCACTGTGGCCCCCGTC
CCTCCTTCGTGA

Retrieve as FASTA