Entry information : SsteCIIBB01
Entry ID 12325
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-20 (Catherine Mathe (Scipio))
Peroxidase information: SsteCIIBB01
Name SsteCIIBB01
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Sphaerobolaceae Sphaerobolus
Organism Sphaerobolus stellatus    [TaxId: 68786 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsteCIIBB01
start..stop
S start..stop
SsteCIIBB02 622 0 1..352 1..350
BaCIIBB03 507 0 3..363 6..364
TvCIIBB15_KN9522 496 2e-177 1..363 1..364
TvCIIBB03 483 2e-172 1..360 1..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 800379..800430 52 N° 2 800483..800544 62 N° 3 800595..800654 60 N° 4 800710..800798 89
N° 5 800851..800873 23 N° 6 800929..800961 33 N° 7 801014..801092 79 N° 8 801150..801364 215
N° 9 801414..801481 68 N° 10 801532..801583 52 N° 11 801636..801702 67 N° 12 801754..801791 38
N° 13 801843..801970 128 N° 14 802028..802075 48 N° 15 802125..802199 75  
join(800379..800430,800483..800544,800595..800654,800710..800798,800851..800873, 800929..800961,801014..801092,801150..801364,801414..801481,801532..801583,80163 6..801702,801754..801791,801843..801970,802028..802075,802125..802199)


exon

Literature and cross-references SsteCIIBB01
DNA ref. JGI genome:   scaffold_1 (800379..802199)
Cluster/Prediction ref. JGI gene:   22957
Protein sequence: SsteCIIBB01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (345)
PWM (Da):   %s   37690.79 (35687.7)  
PI (pH):   %s   4.87 (4.68) Peptide Signal:   %s   cut: 19 range:19-363
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFKSLLAFVALSTSIHAGTVVNKRVTCPDGNIASNACCKFFALRDDLQTNLFDGSKCGEETHESLRLTFHDAIGFSQALKNQGKFPGGGADGVMAFGATEFGFHANAGISDIAGVQMPFAAAHNVSFGDLIQFAGAVGVSNCAGAPRLEFLAGRPAPVAASPDLLIPEPFDTIPKILARFADAGFTPAEVVALLASHTVASDHVDATIPGTPMDSTPSDFDTLFVEVQLRGTGFPGTGGNQGEVESPLAGEIRLQSDHLLARDPATNCEWQSFNNQSKLQTAFRAAMAKLAVVGHNRADLIDCSEVIPIPKPASGPATLPAGKTMNDIEQACATAPFPTLSSDPGPATAIPPVPPS

Retrieve as FASTA  
Remarks complete sequence from genomics (14 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCAAGTCACTTCTTGCCTTTGTTGCACTGTCAACTTCCATTCATGGTCTGTATCCTTGACCTCCTCCTGCTTGAAGTCACTGACTGACATGCTGCAGCCGGTACCGTTGTTAA
CAAACGTGTTACTTGCCCCGACGGTAACATTGCCTCTAATGCCTTC
GTAAGTCATGTTCTCCTGAAATCTACCTACCTAGCTAAGCTTCTGTATAGTGTTGCAAGTTCTTCGCTCTTCGT
GATGACTTACAAACGAATCTCTTTGACGGTTCTAAG
GTGAATATCACTTCAAAAATATGTTGCGTTAGAGGAAGACTGACGGCATACACAGTGCGGTGAAGAAACGCATGAATCCCTTCG
CTTGACCTTCCACGACGCCATTGGTTTCTCTCAAGCTCTCAAAAACCAGGGCAAATTCCC
GTAAGCATTATATATTGTTTACATATACATGTTACTGAGACCCGATATACAGTGGTGGAG
GTGCGGACGGTTCCG
GTAAGCTCTTGATTTTTGAAACCTTCTGCTTGGTCCTAAATGACCTCTGCGATAGTCATGGCATTTGGGGCAACTGAATTCGGATTCCGTAAGAATATATGCTCC
TTCAATCATTTTATCAACTCACAGTCTTTTCCCAGATGCAAACGCTGGTATCAGTGATATTGCAGGCGTCCAAATGCCCTTCGCGGCAGCCCACAACGTCTCTTTCGGCGATCTGTGAGT
TTAGTCTTAGCTTTTATTTTATTTCAATGACAATTCTCACACATCGCAAAGGATTCAATTTGCCGGCGCCGTTGGTGTTTCCAATTGTGCAGGTGCTCCTCGCTTGGAATTCCTCGCCGG
TCGTCCAGCCCCCGTTGCTGCTTCCCCTGATCTCCTGATTCCCGAGCCTTTCGATACTATTCCAAAAATATTGGCCCGTTTTGCCGATGCTGGCTTTACCCCCGCCGAAGTTGTCGCACT
TTTGGCCAGTCACACTGTCGCTGCAT
GTGAGTGGAAAGCCTCTGTCCCTCGTTCTATGCGCTAATAATCGCTCAGCCGACCACGTCGATGCGACCATTCCCGGCACCCCAATGGACTCCA
CCCCGTCGGATTTCGACACCCAA
GTATGTTACAACCATAATAGGCAATTTATATTTGTTTATATTCCATGCAGTTGTTCGTTGAAGTTCAATTAAGGGGTACAGGATTCCCCGGTACTGG
AGGAA
GTAAGTCGTTTTTCACAATTTCATTGGCGGATAATTTATAATCCTCGATTAGACCAGGGGGAAGTCGAATCTCCTCTTGCTGGTGAAATTCGTCTCCAATCCGACCATCTTCTTG
CTCG
GTGAGTAACATAAATCGTTTGGCACTTTCTTCTCTAAACCGTACTGTACAGTGACCCGGCCACCAATTGTGAATGGCAATCTTTCGTTAGTGAGTATAACAGATTCATTTATATGA
CATGTATGCTTAAGATCTCTCCAGACAATCAATCAAAGCTCCAGACCGCCTTCCGTGCTGCGATGGCAAAATTAGCTGTCGTCGGACACAATCGCGCAGATCTCATCGACTGTTCTGAGG
TCATCCCCATTCCCAAGCCCGCTAGTGGCAAG
GTATGTTATTCACCTATACAATCACCGGTGAACCTCAGGAGTTAACGAAATCCGCAGCCCGCAACTCTTCCCGCTGGCAAGACTATGA
ATGATATTGAGCAGGCT
GTGAGTATTAGCACACGTACAACGACCACACTCAAACCTAAGTTTTTAGTGTGCTACTGCACCTTTCCCAACTCTGTCGAGCGACCCTGGCCCAGCCACCGCT
ATTCCTCCTGTCCCACCATCG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCAAGTCACTTCTTGCCTTTGTTGCACTGTCAACTTCCATTCATGCCGGTACCGTTGTTAACAAACGTGTTACTTGCCCCGACGGTAACATTGCCTCTAATGCCTTCTGTTGC
AAGTTCTTCGCTCTTCGTGATGACTTACAAACGAATCTCTTTGACGGTTCTAAG
TGCGGTGAAGAAACGCATGAATCCCTTCGCTTGACCTTCCACGACGCCATTGGTTTCTCTCAAGCT
CTCAAAAACCAGGGCAAATTCCC
TGGTGGAGGTGCGGACGGTTCCGTCATGGCATTTGGGGCAACTGAATTCGGATTCCATGCAAACGCTGGTATCAGTGATATTGCAGGCGTCCAAATG
CCCTTCGCGGCAGCCCACAACGTCTCTTTCGGCGATCT
GATTCAATTTGCCGGCGCCGTTGGTGTTTCCAATTGTGCAGGTGCTCCTCGCTTGGAATTCCTCGCCGGTCGTCCAGCCCCC
GTTGCTGCTTCCCCTGATCTCCTGATTCCCGAGCCTTTCGATACTATTCCAAAAATATTGGCCCGTTTTGCCGATGCTGGCTTTACCCCCGCCGAAGTTGTCGCACTTTTGGCCAGTCAC
ACTGTCGCTGCAT
CCGACCACGTCGATGCGACCATTCCCGGCACCCCAATGGACTCCACCCCGTCGGATTTCGACACCCAATTGTTCGTTGAAGTTCAATTAAGGGGTACAGGATTCCCC
GGTACTGGAGGAA
ACCAGGGGGAAGTCGAATCTCCTCTTGCTGGTGAAATTCGTCTCCAATCCGACCATCTTCTTGCTCGTGACCCGGCCACCAATTGTGAATGGCAATCTTTCGTTAAC
AATCAATCAAAGCTCCAGACCGCCTTCCGTGCTGCGATGGCAAAATTAGCTGTCGTCGGACACAATCGCGCAGATCTCATCGACTGTTCTGAGGTCATCCCCATTCCCAAGCCCGCTAGT
GGCAAG
CCCGCAACTCTTCCCGCTGGCAAGACTATGAATGATATTGAGCAGGCTTGTGCTACTGCACCTTTCCCAACTCTGTCGAGCGACCCTGGCCCAGCCACCGCTATTCCTCCTGTC
CCACCATCG

Retrieve as FASTA