Entry information : SsteCIIBB02
Entry ID 12326
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-20 (Catherine Mathe (Scipio))
Peroxidase information: SsteCIIBB02
Name SsteCIIBB02
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Sphaerobolaceae Sphaerobolus
Organism Sphaerobolus stellatus    [TaxId: 68786 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsteCIIBB02
start..stop
S start..stop
SsteCIIBB01 641 0 1..361 1..363
BaCIIBB03 532 0 3..361 6..364
TvCIIBB15_KN9522 506 0 1..361 1..364
PstrCIIBB02 494 4e-177 1..361 1..359
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 796350..796398 49 N° 2 796456..796514 59 N° 3 796569..796628 60 N° 4 796680..796768 89
N° 5 796821..796843 23 N° 6 796899..796931 33 N° 7 796985..797063 79 N° 8 797116..797330 215
N° 9 797380..797447 68 N° 10 797497..797548 52 N° 11 797602..797668 67 N° 12 797726..797763 38
N° 13 797815..797942 128 N° 14 798000..798047 48 N° 15 798099..798173 75  
join(796350..796398,796456..796514,796569..796628,796680..796768,796821..796843, 796899..796931,796985..797063,797116..797330,797380..797447,797497..797548,79760 2..797668,797726..797763,797815..797942,798000..798047,798099..798173)


exon

Literature and cross-references SsteCIIBB02
DNA ref. JGI genome:   scaffold_1 (796350..798173)
Cluster/Prediction ref. JGI gene:   22956
Protein sequence: SsteCIIBB02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362 (344)
PWM (Da):   %s   37651.96 (35674.8)  
PI (pH):   %s   4.89 (4.70) Peptide Signal:   %s   cut: 18 range:18-361
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFKLLIAFVTLSTVRASVINKRVTCPDGNIASDACCKFFALRDDLQKNLFDGAECGEETHESLRLTFHDAIGFSQALKKQGKFAGGGADGIMAFGDTEFAFHANGGIDDIALTQMPFAAAHNVSFGDLIQFAGAVGVSNCAGAPRLEFLAGRPPPVAASPDLLVPEPFDNIPKILARFADVGFSPAEVVALLASHTVAADHVDPSIPGTPFDSTPSSFDTLFVEVQLRGVSFPGTGGNQGEVESALAGEIRLQSDHLLARDSATSCEWQSFNNQAKLQSAFRAAMAKLAVLGHNRADLIDCSAAVPIPKPAIGAATLPAGKTMNDIEQACATAPFPTLKSDPGPATAVPPVPPS

Retrieve as FASTA  
Remarks complete sequence from genomics (14 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCAAGTTACTTATCGCTTTTGTTACACTGTCAACCGTTCGTGGTCTGTATCTTTGATCTCACCCTTTCTGGATCGAAGTCGTTGACGGTTGTGCCATAGCTAGTGTTATTAAC
AAACGTGTTACTTGCCCCGATGGTAATATTGCTTCCGATGCCTTC
GTAAGTCATATTCTCTTGAAATCTACCTGATTGTATCTAAGCTTCTAGTTGTAGTGCTGCAAGTTTTTCGCCCTC
CGTGATGACTTGCAAAAGAATCTTTTCGATGGCGCTGAA
GTGAGTATCATTTCAAAAACTTGTCACGTTGGAGGGGACTTACGGGAACAGTGCGGCGAAGAAACGCATGAATCGCTTCGT
TTAACGTTCCACGATGCCATTGGTTTCTCCCAAGCCCTCAAAAAACAGGGCAAATTCGC
GTAAGCATTGCATATTGTTCACATATGCTTGTTCGCTGAGCTCGCTATATAGTGGTGGAGG
TGCTGACGGTTCCA
GTAAGCTCTTGATTTTGAAACTTTTACGCTTGACCCTAAAGGATTTTTGCCATAGTCATGGCATTCGGGGATACTGAATTCGCATTCCGTAAGAAGATATCCTCTC
CGTAATCATGCTTTCAGCTCAGAATCTTTTCCCAGATGCTAACGGTGGTATTGATGATATCGCACTTACCCAAATGCCTTTCGCTGCAGCCCACAATGTCTCATTCGGTGATTTGTGAGT
TCAATCCTAATTTTTCTTTACTTTAATACATTCTCATACCGTGAAGGATCCAATTTGCTGGTGCTGTTGGTGTTTCCAATTGCGCGGGTGCTCCTCGCTTGGAATTCCTCGCTGGACGTC
CACCCCCCGTTGCTGCTTCACCTGATCTCCTGGTCCCCGAGCCTTTCGATAATATTCCAAAGATCTTGGCCCGTTTTGCCGATGTTGGTTTCTCTCCCGCCGAGGTTGTTGCACTTTTGG
CTAGTCACACAGTCGCTGCAG
GTAAATGGAAACCCGCCATATCTCGTTCTATGCCCTAACAACCGCTCAGCCGACCACGTCGACCCGTCGATTCCCGGCACTCCATTTGACTCTACCCCA
TCATCTTTCGATACTCAG
GTATGATAAAACAATCATATATAGGATCTATTATTTATGCGCTATTCAGTTGTTCGTTGAGGTTCAATTGAGGGGTGTATCATTCCCTGGAACTGGAGGAAG
TGAGTACATTTTCTTTAGTTTCATTAATGGAGATTTTACAATCCTTGATTAGACCAAGGCGAAGTTGAATCTGCTCTTGCTGGTGAAATCCGTCTCCAATCTGACCATCTTCTTGCTCGG
TAAGTATTGAACCTCAGCTTGTCTTCCCTTTCTCCGCTCTAACCTGCACTTTACAGTGACTCGGCCACCAGCTGTGAATGGCAGTCTTTCGTCAGTGAGTATAGCATATTCAGATAGATG
GCATATATACTCAGATTTTCCACAGACAACCAAGCTAAGCTTCAAAGCGCATTCCGTGCTGCAATGGCGAAATTGGCTGTCCTTGGACACAATCGCGCTGATCTGATCGACTGTTCTGCC
GCCGTTCCCATCCCCAAGCCTGCTATTGGCAAG
GTATGTCCTTCATTTATAACGTCACTCGTAATAGTTAGGGATTAACGAACTGCGTAGGCCGCAACTCTTCCGGCTGGCAAGACTATG
AATGATATTGAACAAGCT
GTGAGTATGTCACCTATACTACAACGACCATACTTATACCGAATGTGTTAGTGTGCTACTGCACCTTTCCCAACTCTGAAGAGTGACCCCGGCCCAGCCACT
GCCGTTCCTCCCGTCCCACCATCG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCAAGTTACTTATCGCTTTTGTTACACTGTCAACCGTTCGTGCTAGTGTTATTAACAAACGTGTTACTTGCCCCGATGGTAATATTGCTTCCGATGCCTTCTGCTGCAAGTTT
TTCGCCCTCCGTGATGACTTGCAAAAGAATCTTTTCGATGGCGCTGAA
TGCGGCGAAGAAACGCATGAATCGCTTCGTTTAACGTTCCACGATGCCATTGGTTTCTCCCAAGCCCTCAAA
AAACAGGGCAAATTCGC
TGGTGGAGGTGCTGACGGTTCCATCATGGCATTCGGGGATACTGAATTCGCATTCCATGCTAACGGTGGTATTGATGATATCGCACTTACCCAAATGCCTTTC
GCTGCAGCCCACAATGTCTCATTCGGTGATTT
GATCCAATTTGCTGGTGCTGTTGGTGTTTCCAATTGCGCGGGTGCTCCTCGCTTGGAATTCCTCGCTGGACGTCCACCCCCCGTTGCT
GCTTCACCTGATCTCCTGGTCCCCGAGCCTTTCGATAATATTCCAAAGATCTTGGCCCGTTTTGCCGATGTTGGTTTCTCTCCCGCCGAGGTTGTTGCACTTTTGGCTAGTCACACAGTC
GCTGCAG
CCGACCACGTCGACCCGTCGATTCCCGGCACTCCATTTGACTCTACCCCATCATCTTTCGATACTCAGTTGTTCGTTGAGGTTCAATTGAGGGGTGTATCATTCCCTGGAACT
GGAGGAA
ACCAAGGCGAAGTTGAATCTGCTCTTGCTGGTGAAATCCGTCTCCAATCTGACCATCTTCTTGCTCGTGACTCGGCCACCAGCTGTGAATGGCAGTCTTTCGTCAACAACCAA
GCTAAGCTTCAAAGCGCATTCCGTGCTGCAATGGCGAAATTGGCTGTCCTTGGACACAATCGCGCTGATCTGATCGACTGTTCTGCCGCCGTTCCCATCCCCAAGCCTGCTATTGGCAAG
GCCGCAACTCTTCCGGCTGGCAAGACTATGAATGATATTGAACAAGCTTGTGCTACTGCACCTTTCCCAACTCTGAAGAGTGACCCCGGCCCAGCCACTGCCGTTCCTCCCGTCCCACCA
TCG

Retrieve as FASTA