Entry information : AimmCcP01
Entry ID 12393
Creation 2013-06-04 (Nizar Fawal)
Last sequence changes 2013-06-04 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-06-24 (Catherine Mathe (Scipio))
Peroxidase information: AimmCcP01
Name AimmCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Pezizomycetes Ascobolaceae Ascobolus
Organism Ascobolus immersus    [TaxId: 5191 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AimmCcP01
start..stop
S start..stop
TborCcP01 483 8e-172 1..384 1..378
MimpCcP01 483 1e-171 1..384 1..380
MconCcP01 483 1e-171 1..384 1..380
CvenCcP01 477 1e-169 1..384 1..379
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 291086..291499 414 N° 2 291586..291742 157 N° 3 291803..292392 590  
join(291086..291499,291586..291742,291803..292392)


exon

Literature and cross-references AimmCcP01
DNA ref. JGI genome:   scaffold_23 (291086..292392)
Cluster/Prediction ref. JGI gene:   413730
Protein sequence: AimmCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   387
PWM (Da):   %s   43025.8  
PI (pH):   %s   8.91
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATAARTLLSRTLQSTARQAFPKPTLRRNLATFNTTSTRTTAQPLRRARQTRFQSTEAAPKKGGNGLLLGALAVAVLGGGGYAYTSGALDAYLVDPEEAKKPKTGKGWIPSFKDYQDVYNDIAAILEDNDYDDGSYAPVLVRLGWHASGTYDKETKTGGSNGATMRFEPEAGHGANAGLVVARDILEKIRQKHPWITYSDLWTLAAVCAIQEMGGPIIPWRPGRTDKDVAACTPDGRLPDASKEHKHIREIFYRMGFNDQEIVALLGAHAIGRCHPDRSGFDGPWTFSPTYFTNSFYKILLETKWIYKKWKGPVQFVDQESGSLMMLPTDMALVKDKEFRKHVERYAADEKTFFDEFAAAFGKLLELGVPFEKDESFRFKRTTDDE

Retrieve as FASTA  
Remarks complete sequence from genomics (2 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACCGCCGCACGAACACTCCTCTCGCGAACTCTCCAATCCACTGCCCGCCAGGCATTCCCAAAGCCAACACTCCGTCGCAACCTCGCAACATTCAACACCACATCCACACGAACA
ACCGCGCAGCCTCTCCGTAGAGCTCGTCAAACGCGCTTCCAGTCGACAGAGGCCGCACCAAAGAAGGGAGGGAATGGATTGCTGCTAGGTGCTCTTGCGGTGGCCGTTCTTGGAGGAGGA
GGTTACGCATACACTTCTGGCGCTCTCGACGCATACCTTGTCGACCCCGAAGAAGCGAAGAAGCCAAAGACCGGAAAGGGCTGGATTCCTTCCTTCAAGGACTATCAGGATGTGTACAAC
GATATCGCTGCCATCCTTGAAGACAACGACTATGATGACGGAAGCTATGCTCCA
GTAGGTGCCCCTGCGGATTCTTCAAGCTGAGGCTGTTTAGGGTTGGAATCGATAGTACAAAGATTG
CTAACTGGTTGATTAATCAGGTCCTCGTGCGCTTGGGATGGCACGCATCGGGAACATACGACAAGGAGACCAAGACGGGCGGATCAAACGGTGCCACGATGAGATTCGAACCAGAGGCAG
GACATGGTGCAAACGCAGGTCTCGTTGTGGCTCGTGACATTTTGGAGAAGATCAGAC
GTAAGTTTTTCGAAGCTGTTTTTCGGCAGGTGTAGCATGAAACTGACGTGCCATTAACAGAGA
AGCATCCATGGATCACCTATTCCGACTTGTGGACTCTGGCCGCCGTTTGTGCTATCCAAGAGATGGGTGGCCCAATTATTCCATGGCGTCCAGGCCGCACCGATAAGGACGTTGCCGCCT
GCACTCCTGATGGACGACTCCCAGATGCCAGCAAGGAACACAAGCACATTCGCGAGATTTTCTACCGCATGGGCTTCAACGACCAGGAGATTGTCGCCTTGCTCGGAGCTCACGCCATTG
GCCGATGCCATCCAGACCGCTCCGGCTTCGATGGACCATGGACCTTCTCCCCAACCTACTTCACCAATTCCTTCTACAAGATCTTGCTCGAGACCAAGTGGATCTACAAGAAGTGGAAGG
GACCAGTTCAGTTTGTTGACCAAGAGTCTGGATCGTTGATGATGTTGCCAACCGATATGGCCCTTGTTAAGGACAAGGAGTTCCGCAAGCATGTTGAGAGATATGCTGCCGACGAGAAGA
CCTTCTTCGACGAGTTTGCTGCTGCCTTTGGAAAGTTGCTTGAGCTTGGTGTGCCATTCGAGAAGGACGAGAGCTTCAGATTCAAGAGGACTACTGATGATGAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACCGCCGCACGAACACTCCTCTCGCGAACTCTCCAATCCACTGCCCGCCAGGCATTCCCAAAGCCAACACTCCGTCGCAACCTCGCAACATTCAACACCACATCCACACGAACA
ACCGCGCAGCCTCTCCGTAGAGCTCGTCAAACGCGCTTCCAGTCGACAGAGGCCGCACCAAAGAAGGGAGGGAATGGATTGCTGCTAGGTGCTCTTGCGGTGGCCGTTCTTGGAGGAGGA
GGTTACGCATACACTTCTGGCGCTCTCGACGCATACCTTGTCGACCCCGAAGAAGCGAAGAAGCCAAAGACCGGAAAGGGCTGGATTCCTTCCTTCAAGGACTATCAGGATGTGTACAAC
GATATCGCTGCCATCCTTGAAGACAACGACTATGATGACGGAAGCTATGCTCCA
GTCCTCGTGCGCTTGGGATGGCACGCATCGGGAACATACGACAAGGAGACCAAGACGGGCGGATCA
AACGGTGCCACGATGAGATTCGAACCAGAGGCAGGACATGGTGCAAACGCAGGTCTCGTTGTGGCTCGTGACATTTTGGAGAAGATCAGAC
AGAAGCATCCATGGATCACCTATTCCGAC
TTGTGGACTCTGGCCGCCGTTTGTGCTATCCAAGAGATGGGTGGCCCAATTATTCCATGGCGTCCAGGCCGCACCGATAAGGACGTTGCCGCCTGCACTCCTGATGGACGACTCCCAGAT
GCCAGCAAGGAACACAAGCACATTCGCGAGATTTTCTACCGCATGGGCTTCAACGACCAGGAGATTGTCGCCTTGCTCGGAGCTCACGCCATTGGCCGATGCCATCCAGACCGCTCCGGC
TTCGATGGACCATGGACCTTCTCCCCAACCTACTTCACCAATTCCTTCTACAAGATCTTGCTCGAGACCAAGTGGATCTACAAGAAGTGGAAGGGACCAGTTCAGTTTGTTGACCAAGAG
TCTGGATCGTTGATGATGTTGCCAACCGATATGGCCCTTGTTAAGGACAAGGAGTTCCGCAAGCATGTTGAGAGATATGCTGCCGACGAGAAGACCTTCTTCGACGAGTTTGCTGCTGCC
TTTGGAAAGTTGCTTGAGCTTGGTGTGCCATTCGAGAAGGACGAGAGCTTCAGATTCAAGAGGACTACTGATGATGAGTAG

Retrieve as FASTA