Entry information : UrCcP03
Entry ID 12400
Creation 2013-06-04 (Nizar Fawal)
Last sequence changes 2016-01-12 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-12 (Achraf Jemmat)
Peroxidase information: UrCcP03
Name UrCcP03
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Onygenaceae Uncinocarpus
Organism Uncinocarpus reesii    [TaxId: 33188 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value UrCcP03
start..stop
S start..stop
CposCcP01 689 0 1..372 1..373
CimCcP02 689 0 1..372 1..373
AderCcP02 611 0 1..371 1..374
TtoCcP01 589 0 1..372 1..369
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6524982..6525356 375 N° 2 6525424..6525580 157 N° 3 6525655..6526010 356 N° 4 6526069..6526299 231
join(6524982..6525356,6525424..6525580,6525655..6526010,6526069..6526299)


exon

Literature and cross-references UrCcP03
DNA ref. GenBank:   CH476615.1 (6524982..6526299)
Protein sequence: UrCcP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   373
PWM (Da):   %s   40879.47 Transmb domain:   %s   i59-81o
PI (pH):   %s   9.44
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAAARTLTRAFARATPATSSAKSSVTRSSLRFTTPAYAFRASSRRGYSSGAEGKKSPSGLLWSLAAVAAGGAGAFYYLGGNQLSNSAKPTVITDPTKEDFQKVYDEIARLLIEKDDYDDGSYGPVLVRLAWHASGTYDKETGTGGSNGATMRFAPESDHGANAGLKAARDFLEPVKQKFPWITYSDLWTLAGACAIQELGGPTIPWRPGRKDSDMSACTPDGRLPDASKDQKHIRAIFGRMGFDDREMVALSGAHALGRAHSDRSGYDGPWDFSPTVFTNDFFKLLLDEKWVQRKWNGPKQFTDNSTKTLMMLPTDMALVKDKEFKKHVERYAKDSDVFFKEFSEVFVKLLELGVPFASKAEDRYVFKASE*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from NCBI (splicing error of intron 2/exon 3)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCGCAGCACGCACCCTCACGAGAGCTTTTGCTCGAGCTACCCCCGCGACCTCTTCCGCAAAGTCCTCGGTAACACGTAGCTCTCTCCGCTTCACCACTCCCGCCTACGCTTTC
CGCGCGTCTTCGCGTCGAGGATACTCTTCCGGCGCTGAAGGCAAGAAGTCGCCGTCCGGGCTCCTTTGGTCTCTCGCTGCTGTTGCTGCTGGTGGTGCTGGTGCTTTCTACTATTTGGGC
GGTAACCAGCTGTCCAACTCGGCAAAGCCGACCGTTATCACCGACCCAACCAAGGAGGACTTCCAGAAAGTTTATGACGAAATCGCACGTCTTCTCATTGAGAAGGATGACTATGATGAT
GGAAGCTATGGACCG
GTAAGTCATTGCATAGCTTCCACTTTCTTGGATCCGAGTCATGAGGCTAAGACCAAAATGATATCAGGTGCTTGTTCGTTTGGCGTGGCATGCTAGCGGTACCTA
CGACAAGGAAACCGGGACTGGAGGAAGCAACGGCGCTACCATGCGTTTCGCTCCCGAGTCGGATCACGGAGCCAATGCTGGCTTGAAGGCCGCGAGAGATTTCCTTGAGCCTGTTAAAC
G
TGAGTTTAAATCCGAGCTCAACCAGGGACATTTGCGGTTGCATTTACTAATAGTCGCAATTTCCCCTCTTTAGAGAAATTCCCCTGGATTACCTATTCCGATCTGTGGACGCTTGCTGGT
GCCTGTGCCATTCAAGAGCTTGGTGGACCTACCATCCCATGGCGCCCCGGCCGTAAGGATTCCGATATGTCTGCCTGCACGCCCGATGGCCGCCTTCCCGACGCGTCCAAGGACCAGAAG
CACATCAGAGCCATTTTCGGCCGCATGGGTTTCGATGATCGCGAGATGGTCGCACTTTCTGGCGCTCACGCTCTTGGACGTGCCCACTCTGACCGATCTGGATATGACGGACCCTGGGAC
TTCAGCCCTACGGTTTTCACCAATGACTTCTTCAAGCTCCTTCTTGATGAGAAGTGGGTTCAGAGAAAG
GTATACTCTCGTCCACCTTCGCTGGCGAAGTTGAAACTGCGACTAACCTAG
TGAATAGTGGAACGGCCCCAAGCAGTTCACCGACAACAGCACCAAGACCTTGATGATGCTGCCAACCGATATGGCTTTGGTGAAGGACAAAGAATTCAAGAAGCACGTTGAACGATACGC
CAAGGACAGCGATGTCTTCTTCAAGGAGTTCTCGGAAGTGTTTGTCAAGCTTCTCGAGCTTGGCGTGCCTTTCGCCTCCAAGGCTGAAGACCGCTATGTTTTCAAGGCCAGCGAATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCGCAGCACGCACCCTCACGAGAGCTTTTGCTCGAGCTACCCCCGCGACCTCTTCCGCAAAGTCCTCGGTAACACGTAGCTCTCTCCGCTTCACCACTCCCGCCTACGCTTTC
CGCGCGTCTTCGCGTCGAGGATACTCTTCCGGCGCTGAAGGCAAGAAGTCGCCGTCCGGGCTCCTTTGGTCTCTCGCTGCTGTTGCTGCTGGTGGTGCTGGTGCTTTCTACTATTTGGGC
GGTAACCAGCTGTCCAACTCGGCAAAGCCGACCGTTATCACCGACCCAACCAAGGAGGACTTCCAGAAAGTTTATGACGAAATCGCACGTCTTCTCATTGAGAAGGATGACTATGATGAT
GGAAGCTATGGACCG
GTGCTTGTTCGTTTGGCGTGGCATGCTAGCGGTACCTACGACAAGGAAACCGGGACTGGAGGAAGCAACGGCGCTACCATGCGTTTCGCTCCCGAGTCGGATCAC
GGAGCCAATGCTGGCTTGAAGGCCGCGAGAGATTTCCTTGAGCCTGTTAAAC
AGAAATTCCCCTGGATTACCTATTCCGATCTGTGGACGCTTGCTGGTGCCTGTGCCATTCAAGAGCTT
GGTGGACCTACCATCCCATGGCGCCCCGGCCGTAAGGATTCCGATATGTCTGCCTGCACGCCCGATGGCCGCCTTCCCGACGCGTCCAAGGACCAGAAGCACATCAGAGCCATTTTCGGC
CGCATGGGTTTCGATGATCGCGAGATGGTCGCACTTTCTGGCGCTCACGCTCTTGGACGTGCCCACTCTGACCGATCTGGATATGACGGACCCTGGGACTTCAGCCCTACGGTTTTCACC
AATGACTTCTTCAAGCTCCTTCTTGATGAGAAGTGGGTTCAGAGAAAG
TGGAACGGCCCCAAGCAGTTCACCGACAACAGCACCAAGACCTTGATGATGCTGCCAACCGATATGGCTTTG
GTGAAGGACAAAGAATTCAAGAAGCACGTTGAACGATACGCCAAGGACAGCGATGTCTTCTTCAAGGAGTTCTCGGAAGTGTTTGTCAAGCTTCTCGAGCTTGGCGTGCCTTTCGCCTCC
AAGGCTGAAGACCGCTATGTTTTCAAGGCCAGCGAATAG

Retrieve as FASTA