Entry information : VaaCP03
Entry ID 12418
Creation 2013-06-04 (Nizar Fawal)
Last sequence changes 2015-11-26 (Christophe Dunand)
Sequence status theoretical translation / pseudogene
Reviewer Achraf Jemmat
Last annotation changes 2015-12-02 (Achraf Jemmat)
Peroxidase information: VaaCP03
Name VaaCP03
Class Catalase peroxidase     [Orthogroup: CP001]*
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Verticillium
Organism Verticillium albo-atrum    [TaxId: 27335 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value VaaCP03
start..stop
S start..stop
VaaCP01 885 0 1..453 1..481
VaaCP01 318 1e-99 460..622 566..728
VdaCP01_VdLs17 880 0 1..453 1..480
VdaCP01_VdLs17 316 1e-98 460..622 600..762
VdaCP01_VdLs17 45 0.00007 90..158 483..559
VdaCP01_longisporum 880 0 1..453 1..480
VdaCP01_longisporum 313 2e-97 460..622 600..762
VdaCP01_longisporum 45 0.00007 90..158 483..559
AclCP01 716 0 4..453 2..481
AclCP01 223 1e-63 452..611 593..751
AclCP01 45 0.00006 90..162 484..564
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2923962..2925230 1269 N° 2 2925313..2925408 96 N° 3 2925777..2926280 504  
join(2923962..2925230,2925313..2925408,2925777..2926280)


exon

Literature and cross-references VaaCP03
Protein ref. GenBank:   EEY16255.1
DNA ref. GenBank:   DS985215.1 (2923962..2926280)
Protein sequence: VaaCP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   622
PWM (Da):   %s   68794.03  
PI (pH):   %s   6.32
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAESESKCPVHKLNNVGGGGTRNRDWWPNALKLNILRQHTDVTNPLGSDFDYAAAFNSLDYNAVKKDLKDLMTDSQDWWPADFGHYGGLFVRMAWHSAGTYRVFDGRGGGGQGQQRFAPLNSWPDNVSLDKARRLLWPIKQKYGNKISWADLLLLTGNVALESMDFKTFGFAGGRADVWEADESVYWGGETTWLGNDVRYSGGNKGDKGPGSLVTDEGHDKGTHTRDLQKPLGAAHMGLIYVNPEGPDGNPDPVAAAHDIRTTFGRMAMNDEETVALIAGGHSFGKTHGAGPNDKIGAEPEGASLEAQGFGWQNGYKSGKGPDTITSGLEVTWTATPTKWSNKYFEYLFKYEWELTKSPAGANQWVAKTDDEIIPDAYDSSKKHRPTMLTTDLSMRFDPEYEKISRRFLENPDQFCRCFRSRLDPIPAVDHPLIDESDIAALKKEILSSGPEPFAPPRAFCRRFRNYGHSTDRVKTEQFLVDRAHLLTLSAPELTALVGGLRVLNTNYDGSQHGVLTKRPGQLSNDFFVNLLDMSTAWKATGSDDELFEGSDRKTGDKRWTATRADLVFGSHAELRALAEVYGSADAEKKFVNDFVAAWTKVSNLDRFDVKKAPAVKTSSRL*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGTCGGAGAGCAAGTGCCCCGTCCACAAACTCAACAATGTCGGCGGCGGCGGCACCCGCAACCGTGACTGGTGGCCCAATGCTCTGAAGCTCAACATTCTCCGTCAGCACACA
GATGTCACGAACCCCCTCGGCAGCGATTTTGACTATGCTGCTGCCTTCAACAGCCTCGACTACAATGCCGTCAAGAAGGACCTCAAGGACCTCATGACCGACTCTCAGGACTGGTGGCCC
GCCGACTTTGGTCACTACGGAGGTCTCTTCGTTCGCATGGCATGGCACAGCGCCGGTACCTACCGCGTCTTCGACGGCCGCGGTGGTGGTGGCCAGGGCCAGCAGCGTTTTGCTCCCCTC
AACAGCTGGCCCGACAACGTCTCGCTCGACAAGGCTCGTCGCCTGTTGTGGCCCATCAAGCAGAAGTACGGCAACAAGATCTCCTGGGCTGATCTGCTGCTTCTCACCGGCAATGTCGCC
CTCGAGTCGATGGACTTCAAGACATTTGGCTTCGCTGGTGGCCGTGCCGACGTCTGGGAGGCCGACGAGTCGGTCTACTGGGGTGGCGAGACCACTTGGCTTGGCAACGACGTCCGCTAC
TCTGGCGGCAACAAGGGCGACAAGGGTCCGGGCAGCCTCGTCACCGACGAGGGCCATGATAAGGGCACCCACACCCGTGACTTGCAGAAGCCTCTCGGTGCTGCCCACATGGGTCTGATC
TACGTCAACCCCGAGGGCCCCGATGGTAACCCCGACCCTGTTGCGGCTGCCCACGACATCCGCACCACCTTCGGCCGCATGGCCATGAACGACGAGGAGACCGTCGCTCTCATTGCTGGT
GGTCACTCCTTCGGCAAGACCCACGGCGCCGGCCCCAACGACAAGATTGGTGCCGAGCCCGAAGGTGCCTCTCTTGAGGCTCAGGGTTTCGGCTGGCAGAACGGATACAAGTCTGGCAAG
GGTCCCGACACCATCACCAGCGGTCTCGAGGTCACCTGGACTGCGACCCCGACCAAGTGGAGCAACAAGTACTTCGAGTACCTCTTTAAGTACGAGTGGGAGCTCACCAAGAGCCCTGCT
GGCGCCAACCAGTGGGTGGCCAAGACGGATGACGAGATCATTCCCGATGCCTACGACTCGTCCAAGAAGCACCGCCCTACCATGCTCACTACCGATCTGTCCATGCGCTTCGATCCCGAG
TACGAGAAGATCTCTCGCCGTTTCCTCGAGAACCCAGACCAGTTTTGCCGATGCTTTCGCTCGCGCCTG
GTTCAAGCTCCTTCACCGTGACCTTGGCCCCAAGGCTCGCTACCTCGGCCC
CGAAATCCCTGCCGAAGACCTCCTGTGGCAGGACCCCATCCCCGCTGTTGACCACCCTCTGATCGACGAGAGCGATATTGCGGCTCTCAAGAAGGAGATCCTCTCCTCCGGACCTGAGCC
CTTCGCA
GTTCATCTCTCTTGTTTGGGGAGCTTCTTCTTTCTTCTCGCGGCAGCGACAGCGCGGTGATGTCAATGGCGCTCGTATCCGCCTGGCCCTTCAAAAGGACTGGGAAGTGTACA
TCGCTCGCCCAGCTGTCCAAGGTATGCAGGCCCTTGAGGGTGGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCAGCCGCCGCCACAGCGTCACCGTCCCCTTCACTCCTGGCCGTGGCGACGCCACGCAGGAGCAGACCGA
CATTGAGTCCGTCAGCCACCTCGAGCCTTTTGCCGACGCTTCCGCAACTACGGCCACTCGACCGACCGCGTCAAGACTGAGCAGTTCCTTGTTGACCGTGCTCACCTCCTGACGCTGTCG
GCGCCTGAGCTGACCGCCCTGGTTGGTGGCCTCCGCGTTCTGAACACCAACTACGACGGATCCCAGCATGGCGTCCTGACCAAGCGCCCCGGCCAGCTGTCCAACGACTTCTTTGTCAAC
CTGCTGGACATGAGCACGGCATGGAAGGCTACCGGCAGCGACGACGAGCTTTTCGAGGGTAGCGACCGCAAGACTGGCGACAAGAGGTGGACTGCCACGCGTGCGGATCTCGTTTTCGGA
TCCCACGCCGAGCTGCGCGCCCTTGCCGAAGTGTACGGCAGTGCCGACGCCGAGAAGAAGTTTGTCAACGACTTTGTCGCGGCGTGGACCAAGGTCTCGAACCTCGACCGCTTCGATGTC
AAGAAGGCGCCTGCCGTCAAGACGTCGAGCCGCCTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGTCGGAGAGCAAGTGCCCCGTCCACAAACTCAACAATGTCGGCGGCGGCGGCACCCGCAACCGTGACTGGTGGCCCAATGCTCTGAAGCTCAACATTCTCCGTCAGCACACA
GATGTCACGAACCCCCTCGGCAGCGATTTTGACTATGCTGCTGCCTTCAACAGCCTCGACTACAATGCCGTCAAGAAGGACCTCAAGGACCTCATGACCGACTCTCAGGACTGGTGGCCC
GCCGACTTTGGTCACTACGGAGGTCTCTTCGTTCGCATGGCATGGCACAGCGCCGGTACCTACCGCGTCTTCGACGGCCGCGGTGGTGGTGGCCAGGGCCAGCAGCGTTTTGCTCCCCTC
AACAGCTGGCCCGACAACGTCTCGCTCGACAAGGCTCGTCGCCTGTTGTGGCCCATCAAGCAGAAGTACGGCAACAAGATCTCCTGGGCTGATCTGCTGCTTCTCACCGGCAATGTCGCC
CTCGAGTCGATGGACTTCAAGACATTTGGCTTCGCTGGTGGCCGTGCCGACGTCTGGGAGGCCGACGAGTCGGTCTACTGGGGTGGCGAGACCACTTGGCTTGGCAACGACGTCCGCTAC
TCTGGCGGCAACAAGGGCGACAAGGGTCCGGGCAGCCTCGTCACCGACGAGGGCCATGATAAGGGCACCCACACCCGTGACTTGCAGAAGCCTCTCGGTGCTGCCCACATGGGTCTGATC
TACGTCAACCCCGAGGGCCCCGATGGTAACCCCGACCCTGTTGCGGCTGCCCACGACATCCGCACCACCTTCGGCCGCATGGCCATGAACGACGAGGAGACCGTCGCTCTCATTGCTGGT
GGTCACTCCTTCGGCAAGACCCACGGCGCCGGCCCCAACGACAAGATTGGTGCCGAGCCCGAAGGTGCCTCTCTTGAGGCTCAGGGTTTCGGCTGGCAGAACGGATACAAGTCTGGCAAG
GGTCCCGACACCATCACCAGCGGTCTCGAGGTCACCTGGACTGCGACCCCGACCAAGTGGAGCAACAAGTACTTCGAGTACCTCTTTAAGTACGAGTGGGAGCTCACCAAGAGCCCTGCT
GGCGCCAACCAGTGGGTGGCCAAGACGGATGACGAGATCATTCCCGATGCCTACGACTCGTCCAAGAAGCACCGCCCTACCATGCTCACTACCGATCTGTCCATGCGCTTCGATCCCGAG
TACGAGAAGATCTCTCGCCGTTTCCTCGAGAACCCAGACCAGTTTTGCCGATGCTTTCGCTCGCGCCTG
GACCCCATCCCCGCTGTTGACCACCCTCTGATCGACGAGAGCGATATTGCG
GCTCTCAAGAAGGAGATCCTCTCCTCCGGACCTGAGCCCTTCGCA
CCACCTCGAGCCTTTTGCCGACGCTTCCGCAACTACGGCCACTCGACCGACCGCGTCAAGACTGAGCAGTTCCTT
GTTGACCGTGCTCACCTCCTGACGCTGTCGGCGCCTGAGCTGACCGCCCTGGTTGGTGGCCTCCGCGTTCTGAACACCAACTACGACGGATCCCAGCATGGCGTCCTGACCAAGCGCCCC
GGCCAGCTGTCCAACGACTTCTTTGTCAACCTGCTGGACATGAGCACGGCATGGAAGGCTACCGGCAGCGACGACGAGCTTTTCGAGGGTAGCGACCGCAAGACTGGCGACAAGAGGTGG
ACTGCCACGCGTGCGGATCTCGTTTTCGGATCCCACGCCGAGCTGCGCGCCCTTGCCGAAGTGTACGGCAGTGCCGACGCCGAGAAGAAGTTTGTCAACGACTTTGTCGCGGCGTGGACC
AAGGTCTCGAACCTCGACCGCTTCGATGTCAAGAAGGCGCCTGCCGTCAAGACGTCGAGCCGCCTGTAA

Retrieve as FASTA