Entry information : AbenCcP02
Entry ID 12429
Creation 2013-06-04 (Nizar Fawal)
Last sequence changes 2016-02-16 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-17 (Achraf Jemmat)
Peroxidase information: AbenCcP02
Name AbenCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP002]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Arthrodermataceae Arthroderma
Organism Arthroderma benhamiae     [TaxId: 63400 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbenCcP02
start..stop
S start..stop
TverCcP02 641 0 1..310 1..310
TrubrCcP01 641 0 1..310 1..310
TrubCcP02 640 0 1..310 1..310
TeqCcP01 640 0 1..310 1..310
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1024..1133 110 N° 2 1205..2027 823  
join(1024..1133,1205..2027)


exon

Literature and cross-references AbenCcP02
Cluster/Prediction ref. Genebank:   9519809 [Incorrect prediction]
Protein sequence: AbenCcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   310
PWM (Da):   %s   34612.97  
PI (pH):   %s   6.06
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSKGDFAAVRRDIAAQMKQPGYDDGSAGPVFVRLAWHSAGTYDIESDTGGSNGAGMRYEAEGGDPANAGLQHGRSFLEPIKAKHPWITYSDLWTLAGVVAIKEMGGPEISWMPGRTDFVDDSKVPPRGRLPDATKGSDHIRHIFYRMGFNDQEIVALSGAHNLGRTHMDRSGFEGPWVNNPTRFSNQYFRLLKKLEWKPRTLSNGTKQFNYVDEDVPEEEREEPLMMLPTDMALLSDPEFAMWVDKYAEDKELFFDHFSKAFHKLMELGIKRNAQGEVINTDNVRGGYISAPKKSDRPTAPDQAPRAHL

Retrieve as FASTA  
Remarks Complete sequence from genomics. Incorrect prediction from NCBI (260 extra aa in 5').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCAGTAAGGGAGACTTCGCCGCCGTCAGGCGTGATATCGCTGCCCAGATGAAGCAGCCTGGGTACGATGATGGAAGCGCAGGCCCTGTCTTCGTCCGGCTCGCATGGTAAGTCCGT
TGTATCTCCTGTTTTTGGCTTGCTCCAGTCCTGAATCGACTGCCGACTGATATCTTCCCAGGCATTCTGCAGGCACATATGACATCGAGAGCGACACGGGAGGCTCGAACGGCGCTGGCA
TGCGCTACGAGGCAGAGGGAGGAGACCCAGCCAACGCCGGACTGCAGCATGGCCGCTCATTTCTCGAGCCCATCAAGGCCAAACACCCCTGGATCACATACTCCGACCTCTGGACGCTCG
CCGGCGTCGTTGCCATCAAGGAGATGGGCGGCCCCGAGATAAGCTGGATGCCCGGCCGGACAGACTTCGTGGACGACTCCAAGGTGCCTCCTCGCGGCCGTCTTCCCGATGCCACCAAGG
GCAGCGACCATATCCGACACATCTTCTACCGCATGGGCTTCAACGACCAGGAGATCGTGGCCCTCTCCGGCGCCCACAACCTGGGCCGCACGCACATGGACCGCAGCGGCTTCGAGGGGC
CCTGGGTCAACAACCCAACCCGGTTCTCAAACCAGTACTTCCGGCTGCTCAAGAAGCTCGAGTGGAAGCCTCGCACGCTCTCGAACGGGACGAAGCAGTTCAACTACGTCGACGAGGACG
TGCCTGAGGAGGAGCGCGAGGAGCCGCTCATGATGCTGCCGACGGACATGGCCCTGCTCTCGGACCCCGAGTTCGCGATGTGGGTGGACAAGTACGCCGAGGACAAGGAGCTCTTCTTCG
ACCACTTCTCCAAGGCCTTCCACAAGCTGATGGAGCTGGGCATCAAGCGCAACGCGCAGGGCGAGGTCATCAACACCGACAACGTCCGCGGCGGATACATCTCTGCGCCCAAGAAGAGCG
ACCGGCCAACCGCGCCAGACCAGGCTCCCAGGGCTCATCTATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCAGTAAGGGAGACTTCGCCGCCGTCAGGCGTGATATCGCTGCCCAGATGAAGCAGCCTGGGTACGATGATGGAAGCGCAGGCCCTGTCTTCGTCCGGCTCGCATGGCATTCTGCA
GGCACATATGACATCGAGAGCGACACGGGAGGCTCGAACGGCGCTGGCATGCGCTACGAGGCAGAGGGAGGAGACCCAGCCAACGCCGGACTGCAGCATGGCCGCTCATTTCTCGAGCCC
ATCAAGGCCAAACACCCCTGGATCACATACTCCGACCTCTGGACGCTCGCCGGCGTCGTTGCCATCAAGGAGATGGGCGGCCCCGAGATAAGCTGGATGCCCGGCCGGACAGACTTCGTG
GACGACTCCAAGGTGCCTCCTCGCGGCCGTCTTCCCGATGCCACCAAGGGCAGCGACCATATCCGACACATCTTCTACCGCATGGGCTTCAACGACCAGGAGATCGTGGCCCTCTCCGGC
GCCCACAACCTGGGCCGCACGCACATGGACCGCAGCGGCTTCGAGGGGCCCTGGGTCAACAACCCAACCCGGTTCTCAAACCAGTACTTCCGGCTGCTCAAGAAGCTCGAGTGGAAGCCT
CGCACGCTCTCGAACGGGACGAAGCAGTTCAACTACGTCGACGAGGACGTGCCTGAGGAGGAGCGCGAGGAGCCGCTCATGATGCTGCCGACGGACATGGCCCTGCTCTCGGACCCCGAG
TTCGCGATGTGGGTGGACAAGTACGCCGAGGACAAGGAGCTCTTCTTCGACCACTTCTCCAAGGCCTTCCACAAGCTGATGGAGCTGGGCATCAAGCGCAACGCGCAGGGCGAGGTCATC
AACACCGACAACGTCCGCGGCGGATACATCTCTGCGCCCAAGAAGAGCGACCGGCCAACCGCGCCAGACCAGGCTCCCAGGGCTCATCTATAG

Retrieve as FASTA