Entry information : PabPrx212 (MA_87008g0010)
Entry ID 12738
Creation 2013-12-19 (Qiang Li)
Last sequence changes 2017-06-09 (Justine Latour)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-06-09 (Justine Latour)
Peroxidase information: PabPrx212 (MA_87008g0010)
Name (synonym) PabPrx212 (MA_87008g0010)
Class Class III peroxidase    [Orthogroup: Prx017]
Taxonomy Eukaryota Viridiplantae Streptophyta Pinaceae Picea
Organism Picea abies (Norway spruce)    [TaxId: 3329 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PabPrx212
start..stop
S start..stop
PabPrx159 656 0 1..339 1..339
PabPrx74 639 0 1..339 1..333
PabPrx170 596 0 1..339 1..339
PabPrx91 555 0 1..339 1..339
Literature and cross-references PabPrx212 (MA_87008g0010)
Protein sequence: PabPrx212 (MA_87008g0010)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339
PWM (Da):   %s   36577.66 Transmb domain:   %s   o15-37i
PI (pH):   %s   8.72
Sequence
Send to BLAST
Send to Peroxiscan
.........1 .........2 .........3 .........4 .........5 .........6 .........7 .........8 .........9 .........0 .........1 .........2
MEYRSIDHPS FLHLVNVAVL ILAVLYPPLI VANAIGLKVG YYRHRCPEAE AIVSAAVAKA VRANPGVAAS LIRMHFHDCF VRGCDGSILI DSTPGNQAEK DSPANNPSLG GFEVIDEAKS  MLEAKCPNVV SCADILAFAA RDSAHQAGGL IWEVEAGRRD GRISSASDIL GNIPAPQSNL NQLTESFARK HLSQEDMVTL SGAHSIGVSH CSSFSASRLY NFSGTGHQDP SMDPKLALVL 
KAKCPKPNSN SNSDPTVPLD LTPRRLDEKY YLDLQVKRGV LTSDQTLMSS PSTSRMVKIN SKYPSVWRKK FGRAMVKMGT IDVLTGSQGE IRKNCRIVN 

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction : errors from congenie.org (repeated sequence : gcagtgttaatactagcagtgttatatcctcctttaatagtagcgaat ; and error about 5' meth)
DNA
Send to BLAST
.........1 .........2 .........3 .........4 .........5 .........6 .........7 .........8 .........9 .........0 .........1 .........2
ATGGAGTATC GATCAATTGA TCATCCCTCG TTTCTTCATT TAGTTAATGT TGCAGTGTTA ATACTAGCAG TGTTATATCC TCCTTTAATA GTAGCGAATG CAGTGTTAAT ACTAGCAGTG  TTATATCCTC CTTTAATAGT AGCGAATGCG ATAGGGTTAA AGGTGGGTTA CTACCGTCAT AGATGCCCTG AGGCGGAGGC AATTGTAAGT GCAGCTGTTG CCAAAGCTGT GAGAGCAAAC  CCTGGCGTTG CAGCTTCTCT CATCAGGATG CATTTCCATG ACTGCTTTGT CAGAGTAAGT ATATCAACTC TTACCCCTGC ATGTTCACAA TTTCAATTTC ATACGATAAT TAGCTAATTG  ATATGCCATG ATTGTAGGGT TGCGATGGAT CAATCCTAAT CGATTCCACA CCGGGAAATC AAGCGGAGAA AGACTCACCG GCAAACAATC CGAGTCTTGG AGGGTTCGAA GTAATTGACG  AAGCAAAGTC AATGTTGGAA GCCAAATGTC CGAATGTCGT CTCATGTGCA GATATCCTTG CTTTCGCAGC AAGAGATAGC GCCCACCAGG TGGGTGATTA ATCCTCAATA TTGTTATTGT  TATCGTTAGC ATTCAAATGG GTAAATTTAT ATCTATATAT ATTGCTGATA TTGTATATTG GGGCAGGCTG GAGGATTAAT TTGGGAAGTT GAAGCAGGAC GAAGAGACGG GAGGATCTCT  TCAGCATCAG ACATCCTAGG GAATATACCT GCTCCACAAT CCAATTTAAA CCAACTCACG GAGAGTTTTG CACGAAAACA TTTATCGCAG GAAGATATGG TCACTCTGTC GGGTAGCTAC  TGTCTGTCTG CAACTTCGTT AATTACTACA ATCATCCATA CTCATATAGA CTGAATTAAA TTGAACGGCT GGCATTACAT TATTAATCGT GCTTTAATAT AATTTAATCT TTCTTTAGGG  GCGCACTCTA TCGGGGTTTC GCACTGTTCT TCATTCAGCG CAAGCAGGCT CTACAATTTC AGTGGAACAG GTCATCAAGA CCCCAGTATG GACCCTAAAT TAGCTTTGGT ACTCAAAGCC  AAATGCCCGA AACCTAATTC TAATTCAAAT TCTGACCCCA CCGTGCCTTT GGATTTGACA CCCAGACGTT TAGATGAGAA ATATTACTTG GATCTTCAAG TAAAGCGTGG AGTGTTGACC  TCTGATCAAA CATTGATGTC GAGTCCATCC ACATCCAGAA TGGTGAAAAT AAACTCGAAG TATCCGTCCG TTTGGAGAAA GAAGTTTGGG AGAGCAATGG TGAAGATGGG AACGATAGAT 
GTGTTGACAG GATCGCAGGG GGAGATCAGG AAAAATTGCC GTATCGTCAA TTGA 

Retrieve as FASTA  
CDS
Send to BLAST
.........1 .........2 .........3 .........4 .........5 .........6 .........7 .........8 .........9 .........0 .........1 .........2
ATGGAGTATC GATCAATTGA TCATCCCTCG TTTCTTCATT TAGTTAATGT TGCAGTGTTA ATACTAGCAG TGTTATATCC TCCTTTAATA GTAGCGAATG CGATAGGGTT AAAGGTGGGT  TACTACCGTC ATAGATGCCC TGAGGCGGAG GCAATTGTAA GTGCAGCTGT TGCCAAAGCT GTGAGAGCAA ACCCTGGCGT TGCAGCTTCT CTCATCAGGA TGCATTTCCA TGACTGCTTT  GTCAGAGGTT GCGATGGATC AATCCTAATC GATTCCACAC CGGGAAATCA AGCGGAGAAA GACTCACCGG CAAACAATCC GAGTCTTGGA GGGTTCGAAG TAATTGACGA AGCAAAGTCA  ATGTTGGAAG CCAAATGTCC GAATGTCGTC TCATGTGCAG ATATCCTTGC TTTCGCAGCA AGAGATAGCG CCCACCAGGC TGGAGGATTA ATTTGGGAAG TTGAAGCAGG ACGAAGAGAC  GGGAGGATCT CTTCAGCATC AGACATCCTA GGGAATATAC CTGCTCCACA ATCCAATTTA AACCAACTCA CGGAGAGTTT TGCACGAAAA CATTTATCGC AGGAAGATAT GGTCACTCTG  TCGGGGGCGC ACTCTATCGG GGTTTCGCAC TGTTCTTCAT TCAGCGCAAG CAGGCTCTAC AATTTCAGTG GAACAGGTCA TCAAGACCCC AGTATGGACC CTAAATTAGC TTTGGTACTC  AAAGCCAAAT GCCCGAAACC TAATTCTAAT TCAAATTCTG ACCCCACCGT GCCTTTGGAT TTGACACCCA GACGTTTAGA TGAGAAATAT TACTTGGATC TTCAAGTAAA GCGTGGAGTG  TTGACCTCTG ATCAAACATT GATGTCGAGT CCATCCACAT CCAGAATGGT GAAAATAAAC TCGAAGTATC CGTCCGTTTG GAGAAAGAAG TTTGGGAGAG CAATGGTGAA GATGGGAACG 
ATAGATGTGT TGACAGGATC GCAGGGGGAG ATCAGGAAAA ATTGCCGTAT CGTCAATTGA 

Retrieve as FASTA