Entry information : PabPrx91 (MA_114903g0010)
Entry ID 12817
Creation 2013-12-19 (Qiang Li)
Last sequence changes 2017-06-09 (Justine Latour)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-06-09 (Justine Latour)
Peroxidase information: PabPrx91 (MA_114903g0010)
Name (synonym) PabPrx91 (MA_114903g0010)
Class Class III peroxidase    [Orthogroup: Prx017]
Taxonomy Eukaryota Viridiplantae Streptophyta Pinaceae Picea
Organism Picea abies (Norway spruce)    [TaxId: 3329 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PabPrx91
start..stop
S start..stop
PabPrx170 628 0 1..339 1..339
PabPrx159 558 0 1..339 1..339
PabPrx212 555 0 1..339 1..339
PabPrx74 552 0 1..339 1..333
Literature and cross-references PabPrx91 (MA_114903g0010)
Protein sequence: PabPrx91 (MA_114903g0010)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339
PWM (Da):   %s   36618.4  
PI (pH):   %s   5.62
Sequence
Send to BLAST
Send to Peroxiscan
.........1 .........2 .........3 .........4 .........5 .........6 .........7 .........8 .........9 .........0 .........1 .........2
MDYRTIDHRC LLNLVGAIVI VAELSPPVLV ENANGLKVGY YRHTCPEAEV IVSVVVAKAV IANPGVAPSL IRMHFHDCFV RGCDGSILID STPGNQAEKD SPVNNPSLQG FEVIDEAKSI  LEAKCPNVVS CADILAFAAR DGAFLAGGLI WEEEAGRRDG RISRASDIPG NIPAPQFNVN QLEQNFAAKH MSQEDMVTLS GAHSIGVSHC SSFSANRLYN FSGTGQQDPS MDPGFALLLK 
AKCPIQNSDS NFDPIVPLDS LTPSILDGKY YWDLQLKRGV LTSDQTLMSN PSTSEMVKIN SVYPFIWGKK FGSAMVKMGA IDVLTGSNGE IRKVCRIIN* 

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction : modified from congenie.org (5' unfounded, frame shift just after"VAKAV", repetition of 2 sequences = suppression : GAACGGATTAAAGGTGGGTTACTACCGTCATACGTGCCCCGAGG
ggaggtgattgtaagtgtagttgtggcgaaagccgtgatagcaaatcctggcgttgcaccttctcttatcaggatgcatttccatgactgctttgtcaga)
DNA
Send to BLAST
.........1 .........2 .........3 .........4 .........5 .........6 .........7 .........8 .........9 .........0 .........1 .........2
ATGGATTATC GAACAATTGA TCATCGCTGT TTACTTAATT TAGTAGGAGC AATTGTAATA GTAGCAGAGT TATCTCCTCC TGTACTAGTA GAAAATGCGA ACGGATTAAA GGTGGGTTAC  TACCGTCATA CGTGCCCCGA GGGAACGGAT TAAAGGTGGG TTACTACCGT CATACGTGCC CCGAGGCGGA GGTGATTGTA AGTGTAGTTG TGGCGAAAGC CGTGATAGCA AATCCTGGCG  TTGCACCTTC TCTTATCAGG ATGCATTTCC ATGACTGCTT TGTCAGAGTA AGTATATCAA CTCTCAAAAC AATCAGTAGT ATACATCAAT TTCATGAATA CGATAATCAG CTAATTGATA  CGCTTACAGG GATGCGATGG ATCAATACTT ATCGACTCAA CGCCGGGAAA TCAAGCAGAG AAAGACTCGC CGGTAAACAA TCCGAGCCTT CAAGGGTTCG AAGTCATTGA CGAAGCAAAG  TCGATATTGG AAGCCAAATG TCCGAATGTG GTCTCATGTG CAGACATCCT TGCTTTCGCT GCAAGAGATG GCGCTTTCCT GGTTGGTGAT TAATATTCAA TATTGTTATT GTTAATATTC  AAGTGGGTAC CTGTATATCT ATATAGATAT TGATGATATT ATATATTGGC TCAGGCTGGA GGATTAATTT GGGAGGAGGA AGCAGGACGA AGAGACGGAA GGATCTCTCG AGCATCAGAC  ATCCCAGGGA ATATACCTGC TCCACAATTC AATGTAAACC AACTCGAGCA AAATTTTGCT GCAAAACACA TGTCCCAGGA AGACATGGTC ACTCTATCAG GTAGCTGCTG ATTAACTCTT  AAAAGCATGC ATTCATATAG TTGTGTGATT CAGTTGAACT CATGGGATCC CGTCATCATA TTCATGCGTT AATATAATTT AATCTTCTAT TAATTTGCAG GGGCGCACTC TATTGGGGTT  TCGCATTGCT CTTCATTCAG CGCAAATAGG CTTTACAATT TCAGTGGAAC AGGTCAACAG GACCCCAGTA TGGACCCTGG ATTCGCTTTG TTGCTCAAAG CCAAATGCCC AATACAAAAT  TCTGATTCAA ACTTTGATCC CATCGTGCCT TTGGATTCAT TAACACCCAG TATTTTAGAT GGGAAATATT ACTGGGATCT TCAGTTAAAG CGTGGAGTGT TGACCTCTGA TCAAACGTTG  ATGTCGAATC CATCCACTTC CGAAATGGTG AAGATCAACT CTGTGTATCC GTTCATTTGG GGAAAGAAGT TTGGGAGCGC AATGGTGAAA ATGGGCGCAA TAGACGTGTT GACTGGGTCG 
AATGGGGAGA TCAGGAAAGT TTGCCGCATC ATCAACTGA 

Retrieve as FASTA  
CDS
Send to BLAST
.........1 .........2 .........3 .........4 .........5 .........6 .........7 .........8 .........9 .........0 .........1 .........2
ATGGATTATC GAACAATTGA TCATCGCTGT TTACTTAATT TAGTAGGAGC AATTGTAATA GTAGCAGAGT TATCTCCTCC TGTACTAGTA GAAAATGCGA ACGGATTAAA GGTGGGTTAC  TACCGTCATA CGTGCCCCGA GGCGGAGGTG ATTGTAAGTG TAGTTGTGGC GAAAGCCGTG ATAGCAAATC CTGGCGTTGC ACCTTCTCTT ATCAGGATGC ATTTCCATGA CTGCTTTGTC  AGAGGATGCG ATGGATCAAT ACTTATCGAC TCAACGCCGG GAAATCAAGC AGAGAAAGAC TCGCCGGTAA ACAATCCGAG CCTTCAAGGG TTCGAAGTCA TTGACGAAGC AAAGTCGATA  TTGGAAGCCA AATGTCCGAA TGTGGTCTCA TGTGCAGACA TCCTTGCTTT CGCTGCAAGA GATGGCGCTT TCCTGGCTGG AGGATTAATT TGGGAGGAGG AAGCAGGACG AAGAGACGGA  AGGATCTCTC GAGCATCAGA CATCCCAGGG AATATACCTG CTCCACAATT CAATGTAAAC CAACTCGAGC AAAATTTTGC TGCAAAACAC ATGTCCCAGG AAGACATGGT CACTCTATCA  GGGGCGCACT CTATTGGGGT TTCGCATTGC TCTTCATTCA GCGCAAATAG GCTTTACAAT TTCAGTGGAA CAGGTCAACA GGACCCCAGT ATGGACCCTG GATTCGCTTT GTTGCTCAAA  GCCAAATGCC CAATACAAAA TTCTGATTCA AACTTTGATC CCATCGTGCC TTTGGATTCA TTAACACCCA GTATTTTAGA TGGGAAATAT TACTGGGATC TTCAGTTAAA GCGTGGAGTG  TTGACCTCTG ATCAAACGTT GATGTCGAAT CCATCCACTT CCGAAATGGT GAAGATCAAC TCTGTGTATC CGTTCATTTG GGGAAAGAAG TTTGGGAGCG CAATGGTGAA AATGGGCGCA 
ATAGACGTGT TGACTGGGTC GAATGGGGAG ATCAGGAAAG TTTGCCGCAT CATCAACTGA 

Retrieve as FASTA