Entry information : TmiAPx-CcP_UCR-PA7 (TmiHyBpox1)
Entry ID 12858
Creation 2014-02-25 (Marcel Zamocky)
Last sequence changes 2014-03-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-10-15 (Christophe Dunand)
Peroxidase information: TmiAPx-CcP_UCR-PA7 (TmiHyBpox1)
Name (synonym) TmiAPx-CcP_UCR-PA7 (TmiHyBpox1)
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Calosphaeriaceae Togninia
Organism Togninia minima    [TaxId: 223192 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TmiAPx-CcP_UCR-PA7
start..stop
S start..stop
GgrAPx-CcP2 1027 0 8..930 7..949
TviAPx-CcP01 974 0 8..929 7..907
HjAPx-CcP01 966 0 8..929 7..921
HjAPx-CcP01 132 1e-31 610..711 826..927
TaspAPx-CcP01 961 0 20..929 19..910
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 398924..400724 1801 N° 2 398354..398530 177 N° 3 398174..398295 122 N° 4 397907..398012 106
N° 5 397214..397809 596  
complement(join(397214..397809,397907..398012,398174..398295,398354..398530,3989 24..400724))


exon

Literature and cross-references TmiAPx-CcP_UCR-PA7 (TmiHyBpox1)
Literature Blanco-Ulate B., Rolshausen P., Cantu D. (2013) Draft genome sequence of the ascomycete Phaeoacremonium aleophilum strain UCR-PA7, a causal agent of the esca disease complex in grapevines. Genome Announc. 1:E0039013-E0039013
Protein ref. GenBank:   EOO01415.1 [Incorrect prediction] UniProtKB:   R8BQ60 [Incorrect prediction]
DNA ref. GenBank:   KB932993.1 (400983..397214)
Protein sequence: TmiAPx-CcP_UCR-PA7 (TmiHyBpox1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   933 (913)
PWM (Da):   %s   97287.48 (95276.3)  
PI (pH):   %s   4.77 (4.72) Peptide Signal:   %s   cut: 21 range:21-933
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRANLSLLAGLLSLTATVVSDVTWPASTDELEEIMYQLYGFNARLFADNVTPCTKEASGPGRQNAAEWLRVAFHDMATANPYFGLGGIDSSLMFELNNGENTGPGHNTTLQTYANYLSSRSSMSDLIALGTYASVRSCGGPIIPIKGGRIDATSAGSPGVPQPQNAISIFISQFSRMGFTQTEMIQLTACGHTLGGVHSPEFPALVPPGSATNDEAALDTTPGAFDNNVVTEYLDGTTKNPLVVGPSVALKQNSDFVVFNSDNNATMQGLRDAAVFKSTCGTLFQRMIDIVPSGVTLSAAITPYTVKPVNMQLTLNTGGSTMLLTGYIRVRTTTLTQAISTVTLTYKNRNGASSCGGSCSTTAIVTGTTRGFDDSFEFFPISTSIPTATGISSFTVTVTLADGTTQTYDNNGNSYPISDAVFIQKPQSCLLQGTGALTVSALVRNDRTSLPVNVTVTYKTARTGIAAPKLNTASIALTKGNCVGAYTFYSTSYTITGGMSSLAKLDIVSGSGTDVVSDSFKAASDLAGTCATYSGSAACGSVTVSSVIPSSTLATVTTTSSIAPTATLEHKSKIGGYNLVSCWTEGTGVRALSGAAFAYDGTLGIKPIIGKYSFVGCWTEGTGVRALSASTYADDAMTLESCAAFCSAYKYFGTEYGRECYCGDTLAASSASAPVADCNMICAGSPLQYCGAGNRLELYQQRGPIIQQAELDDILCDLIYVKHSATNHNIKFGAEGTGSRALAGAAYTNNTAMTLESCAAFCSNFKYFGTEYGQECYCGNTLSSSSAAAPLADCSMTCSGNPLEYCGAGNRLELYVNNASTSTGPTQPSNVGTAWTWYGCQTEATTGRALSSVSYAADTMTLESCASFCDGFDYFGVEYARECYCGNTFGAGSVNAPPSDCSMTCAANSNEYCGAGNRLSVYYKAQSKRRGY

Retrieve as FASTA  
Remarks Complete sequence from genomic (unknown chromo, 5 introns). Incorrect prediction from NCBI (first exon with one aa). Strain="UCR-PA7". Comprises peroxidase domain fused with WSC domain. No EST available.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCGCCAACCTCTCTCTCCTCGCCGGCCTGTTGTCCCTGACGGCGACTGTCGTCTCAGACGTAACATGGCCGGCCTCAACGGACGAACTGGAGGAGATAATGTACCAGTTGTACGGA
TTCAATGCTCGACTCTTCGCCGATAACGTAACCCCGTGTACGAAGGAGGCATCAGGACCGGGTCGACAGAATGCCGCTGAGTGGCTTCGCGTTGCCTTCCATGATATGGCAACTGCCAAC
CCATACTTCGGCCTTGGTGGCATCGATAGTTCTTTGATGTTCGAGTTGAACAATGGAGAGAATACCGGACCAGGTCATAACACGACTCTGCAAACTTACGCGAACTACCTCTCGTCCAGG
AGTAGCATGTCAGATCTAATTGCTCTGGGAACATATGCGTCGGTACGGTCTTGTGGTGGACCAATTATCCCCATCAAGGGTGGACGAATCGATGCAACATCAGCGGGTAGCCCGGGCGTC
CCCCAGCCACAGAATGCTATCAGCATTTTCATCTCGCAGTTTTCCCGAATGGGTTTCACTCAGACAGAGATGATTCAGCTTACCGCTTGTGGTCACACACTGGGCGGAGTTCACTCCCCA
GAGTTTCCAGCTCTGGTGCCCCCCGGTTCTGCAACAAATGACGAAGCCGCCCTGGACACTACTCCCGGAGCCTTTGACAATAACGTTGTCACGGAGTATCTCGATGGAACGACTAAGAAC
CCTCTTGTTGTAGGGCCGTCTGTTGCCCTTAAGCAGAACTCTGATTTTGTTGTCTTCAATTCTGACAACAATGCCACAATGCAAGGCTTGAGAGATGCCGCTGTCTTCAAGAGTACCTGT
GGCACCCTTTTCCAAAGAATGATCGACATTGTCCCGTCCGGCGTTACTCTGTCTGCCGCTATCACGCCATATACCGTCAAGCCTGTCAATATGCAACTCACCTTGAACACTGGAGGCTCA
ACAATGCTACTGACCGGTTACATTCGTGTTCGAACGACAACATTGACCCAAGCGATCTCGACCGTCACGTTGACTTATAAGAACCGGAACGGCGCTAGCAGTTGCGGTGGAAGCTGCAGT
ACCACAGCCATTGTCACTGGCACGACACGGGGTTTCGATGATAGCTTTGAGTTCTTCCCAATCTCCACCAGCATCCCAACGGCAACCGGTATTTCATCGTTCACTGTCACCGTCACTCTT
GCGGATGGCACCACCCAGACTTATGACAACAATGGAAACTCCTATCCGATATCTGATGCTGTCTTCATCCAAAAGCCACAGAGTTGTCTTCTTCAGGGAACCGGCGCTCTCACTGTTTCG
GCCTTGGTTCGCAACGACCGCACGTCGCTGCCAGTGAACGTGACTGTCACCTACAAAACGGCACGAACGGGCATCGCGGCTCCCAAGCTCAACACCGCGAGCATCGCCCTGACCAAGGGC
AACTGTGTAGGTGCTTACACCTTCTATAGCACTAGCTACACGATCACTGGAGGCATGAGCTCTCTAGCCAAGCTGGATATTGTAAGCGGTAGCGGCACCGATGTTGTCTCTGATTCATTC
AAGGCCGCCTCCGATTTGGCTGGTACCTGTGCCACCTACTCTGGAAGCGCCGCCTGTGGATCTGTTACGGTCAGCTCGGTAATCCCATCTTCAACTCTTGCCACCGTCACAACGACTAGC
AGTATTGCTCCAACCGCTACGCTTGAGCACAAGTCGAAGATCGGAGGATACAACTTGGTGTCCTGCTGGACTGAGGGAACTGGCGTACGAGCTCTATCCGGTGCTGCATTCGCCTATGAC
G
GTATGACTTTGGAAACCTGCATGAGCAACTGCACCGGGTTCGCATACTGGGGTACCGAGTATGGACGTGAATGCTACTGCGGCAACACACTCGCCAGCAGTAGTTCATCTGCACCCTTG
GCTGATTGCAATATGGTCTGCGGTGGCAATCCCCTCGAGTACTGTGGCGCGGGCAATCGCCTTGAGCTATATCTCACGTCAACGGCTTCCTTGCCCTCTTCGACATCTTCAACTGTTGCG
TCTTCGTCAACTCTAGCTACGTCGACATCTTCTACCGTTGCGTCTTCGTCAACATCGAAGCCTATCTCTTCATCAGTCTCGTCAACTGTAGGTACCTCAACATCCACAATTGTATCCTCT
TCAACTTCGACCTCGACATCCGCTGCTCCCACAGGCACACTGGGTATCAAGCCCATCATCGGAAAGTATTCCTTCGTCGGATGCTGGACAGAGGGAACAGGCGTGCGAGCTCTTTCCGCG
AGCACGTATGCGGATGATGCCATGACCTTGGAGTCTTGTGCTGCGTTCTGCTCGGCCTACAAGTACTTCGGAACCGAGTATGGCCGTGAAT
GTATGTTTCCGTCCCTTCACCTAACCTAT
TTGACTCAGTACTGACTTCGGCATTCAAGGCTATTGTGGCGACACTCTTGCTGCTTCAAGCGCCTCTGCTCCCGTCGCCGATTGCAACATGATTTGTGCCGGCAGCCCCTTACAGTATTG
CGGAGCAGGCAACCGCCTTGAGCTCTATTCC
GTTGCTGCTGTCTCGTCTTCATCAAGCACTGGTGGTCTCAGTTCCCGGGGCATAAGCTCATCGACCTCTAGCTCAGCTCCTATAACAAG
CAGCAGCAGCAGCGTAGCTCCTTCGTTGAGCAAGCCGAGCTCGACAACATCTAGCTCAACTCTTATATCTAGCAGCAGCGCGGCCCCATCATCCAGCAAGCTGAGCTCGACGACATCCTC
TGTGATCTCATCTACGTCAAGCACTCGGCCACCAACCACAACATCAAGTTCGGTGCCG
GTGAGCTCGACTAAGACATCTTCCTCCTCTAGCACGGTCACGACCCTGGCTCATCGGCCCAC
TATCAGCCCCTACAGCTTTGTTGGGTGCTGGACAGAAGGTACTGGCTCGCGTGCTCTGGCTGGTGCCGCGTATACCAACAACACAGCCATGACGCTCGAGTCCTGCGCCGCCTTCTGCAG
CAACTTCAAGTACTTCGGTACCGAGTACGGCCAGGAGTGCTACTGTGGCAACACACTGTCCAGCTCATCTGCGGCTGCTCCTCTCGCCGATTGTTCGATGACATGCTCGGGCAATCCCCT
TGAGTACTGTGGTGCGGGTAACCGACTAGAGCTGTATGTCAACAATGCATCGACAAGCACTGGCCCCACGCAGCCAAGCAACGTCGGCACCGCTTGGACATGGTACGGCTGCCAGACCGA
AGCCACCACCGGCCGCGCGCTCAGCAGCGTCAGCTATGCGGCCGACACCATGACGCTCGAGAGCTGCGCGAGCTTCTGCGACGGCTTTGACTACTTTGGCGTCGAGTACGCACGCGAGTG
CTACTGCGGCAACACCTTCGGCGCCGGCTCGGTGAACGCGCCCCCGTCGGATTGCAGCATGACGTGCGCGGCGAACTCGAACGAGTATTGCGGCGCGGGCAACAGGCTGAGCGTCTACTA
TAAGGCACAGTCTAAGCGACGGGGGTATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCGCCAACCTCTCTCTCCTCGCCGGCCTGTTGTCCCTGACGGCGACTGTCGTCTCAGACGTAACATGGCCGGCCTCAACGGACGAACTGGAGGAGATAATGTACCAGTTGTACGGA
TTCAATGCTCGACTCTTCGCCGATAACGTAACCCCGTGTACGAAGGAGGCATCAGGACCGGGTCGACAGAATGCCGCTGAGTGGCTTCGCGTTGCCTTCCATGATATGGCAACTGCCAAC
CCATACTTCGGCCTTGGTGGCATCGATAGTTCTTTGATGTTCGAGTTGAACAATGGAGAGAATACCGGACCAGGTCATAACACGACTCTGCAAACTTACGCGAACTACCTCTCGTCCAGG
AGTAGCATGTCAGATCTAATTGCTCTGGGAACATATGCGTCGGTACGGTCTTGTGGTGGACCAATTATCCCCATCAAGGGTGGACGAATCGATGCAACATCAGCGGGTAGCCCGGGCGTC
CCCCAGCCACAGAATGCTATCAGCATTTTCATCTCGCAGTTTTCCCGAATGGGTTTCACTCAGACAGAGATGATTCAGCTTACCGCTTGTGGTCACACACTGGGCGGAGTTCACTCCCCA
GAGTTTCCAGCTCTGGTGCCCCCCGGTTCTGCAACAAATGACGAAGCCGCCCTGGACACTACTCCCGGAGCCTTTGACAATAACGTTGTCACGGAGTATCTCGATGGAACGACTAAGAAC
CCTCTTGTTGTAGGGCCGTCTGTTGCCCTTAAGCAGAACTCTGATTTTGTTGTCTTCAATTCTGACAACAATGCCACAATGCAAGGCTTGAGAGATGCCGCTGTCTTCAAGAGTACCTGT
GGCACCCTTTTCCAAAGAATGATCGACATTGTCCCGTCCGGCGTTACTCTGTCTGCCGCTATCACGCCATATACCGTCAAGCCTGTCAATATGCAACTCACCTTGAACACTGGAGGCTCA
ACAATGCTACTGACCGGTTACATTCGTGTTCGAACGACAACATTGACCCAAGCGATCTCGACCGTCACGTTGACTTATAAGAACCGGAACGGCGCTAGCAGTTGCGGTGGAAGCTGCAGT
ACCACAGCCATTGTCACTGGCACGACACGGGGTTTCGATGATAGCTTTGAGTTCTTCCCAATCTCCACCAGCATCCCAACGGCAACCGGTATTTCATCGTTCACTGTCACCGTCACTCTT
GCGGATGGCACCACCCAGACTTATGACAACAATGGAAACTCCTATCCGATATCTGATGCTGTCTTCATCCAAAAGCCACAGAGTTGTCTTCTTCAGGGAACCGGCGCTCTCACTGTTTCG
GCCTTGGTTCGCAACGACCGCACGTCGCTGCCAGTGAACGTGACTGTCACCTACAAAACGGCACGAACGGGCATCGCGGCTCCCAAGCTCAACACCGCGAGCATCGCCCTGACCAAGGGC
AACTGTGTAGGTGCTTACACCTTCTATAGCACTAGCTACACGATCACTGGAGGCATGAGCTCTCTAGCCAAGCTGGATATTGTAAGCGGTAGCGGCACCGATGTTGTCTCTGATTCATTC
AAGGCCGCCTCCGATTTGGCTGGTACCTGTGCCACCTACTCTGGAAGCGCCGCCTGTGGATCTGTTACGGTCAGCTCGGTAATCCCATCTTCAACTCTTGCCACCGTCACAACGACTAGC
AGTATTGCTCCAACCGCTACGCTTGAGCACAAGTCGAAGATCGGAGGATACAACTTGGTGTCCTGCTGGACTGAGGGAACTGGCGTACGAGCTCTATCCGGTGCTGCATTCGCCTATGAC
G
GCACACTGGGTATCAAGCCCATCATCGGAAAGTATTCCTTCGTCGGATGCTGGACAGAGGGAACAGGCGTGCGAGCTCTTTCCGCGAGCACGTATGCGGATGATGCCATGACCTTGGAG
TCTTGTGCTGCGTTCTGCTCGGCCTACAAGTACTTCGGAACCGAGTATGGCCGTGAAT
GCTATTGTGGCGACACTCTTGCTGCTTCAAGCGCCTCTGCTCCCGTCGCCGATTGCAACATG
ATTTGTGCCGGCAGCCCCTTACAGTATTGCGGAGCAGGCAACCGCCTTGAGCTCTATTCC
CAGCAGCGCGGCCCCATCATCCAGCAAGCTGAGCTCGACGACATCCTCTGTGATCTCATC
TACGTCAAGCACTCGGCCACCAACCACAACATCAAGTTCGGTGCCG
AAGGTACTGGCTCGCGTGCTCTGGCTGGTGCCGCGTATACCAACAACACAGCCATGACGCTCGAGTCCTGCGCC
GCCTTCTGCAGCAACTTCAAGTACTTCGGTACCGAGTACGGCCAGGAGTGCTACTGTGGCAACACACTGTCCAGCTCATCTGCGGCTGCTCCTCTCGCCGATTGTTCGATGACATGCTCG
GGCAATCCCCTTGAGTACTGTGGTGCGGGTAACCGACTAGAGCTGTATGTCAACAATGCATCGACAAGCACTGGCCCCACGCAGCCAAGCAACGTCGGCACCGCTTGGACATGGTACGGC
TGCCAGACCGAAGCCACCACCGGCCGCGCGCTCAGCAGCGTCAGCTATGCGGCCGACACCATGACGCTCGAGAGCTGCGCGAGCTTCTGCGACGGCTTTGACTACTTTGGCGTCGAGTAC
GCACGCGAGTGCTACTGCGGCAACACCTTCGGCGCCGGCTCGGTGAACGCGCCCCCGTCGGATTGCAGCATGACGTGCGCGGCGAACTCGAACGAGTATTGCGGCGCGGGCAACAGGCTG
AGCGTCTACTATAAGGCACAGTCTAAGCGACGGGGGTATTAG

Retrieve as FASTA