Entry information : PparaPrxQ_P1569 (PPTG_08167T0)
Entry ID 12884
Creation 2014-03-17 (Christophe Dunand)
Last sequence changes 2014-03-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-03-17 (Christophe Dunand)
Peroxidase information: PparaPrxQ_P1569 (PPTG_08167T0)
Name (synonym) PparaPrxQ_P1569 (PPTG_08167T0)
Class Atypical 2-Cysteine peroxiredoxin (type Q)    [Orthogroup: PrxQ001]
Taxonomy Eukaryota Phytophthora
Organism Phytophthora parasitica    [TaxId: 4792 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PparaPrxQ_P1569
start..stop
S start..stop
PiPrxQ 667 0 1..370 1..370
PsojPrxQ 651 0 14..370 15..370
PraPrxQ 649 0 1..370 1..369
PcapPrxQ 642 0 1..370 1..365
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28146..28431 286 N° 2 28515..29341 827  
join(28146..28431,28515..29341)


exon

Literature and cross-references PparaPrxQ_P1569 (PPTG_08167T0)
DNA ref. GenBank:   ANIZ01000760.1 (28146..29341)
Protein sequence: PparaPrxQ_P1569 (PPTG_08167T0)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   370
PWM (Da):   %s   39564.99  
PI (pH):   %s   6.79
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVSTRSRTNSGSSSAAELPQKRSATADASKRPAKKPTTPKAAASDLAVGKSVTTDVTLVNQEEKEVVIADTFRDQGVVFFMYPRANTPGCTKQACGFRDNIQTIKDAGFTVYGLSGDSPKSLTNWKTKQSLPFDLLSDPEHKLISYFGSSLPGNKVQRSHVVILKGGVVGDIAAKVSPADSVSRAVEFVKKSSGAEAPKEDEPTKEEEPTDTEKFAVGNTVTFDGELQTDASATVKVQDLFKTRGAIFFMYPKADTPGCTTQACGYNDNLEAINAAGFDVYGLGADTPAELLAWKESQKYKYTFLSDPKHQLIGYFGSSINDGTRVERSHVIVLPGGKVGQIEHNISPQDSVSKGLEFAKSHTIDAASKL

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Strain="P1569", "P10297", "IAC_01/95", "CHvinca01"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGTCCACTCGCAGCCGCACGAACTCGGGCTCGTCATCCGCCGCTGAGCTGCCGCAGAAGCGCTCGGCCACCGCAGATGCGTCCAAACGCCCGGCCAAGAAGCCCACGACGCCCAAG
GCCGCCGCCAGCGATCTGGCCGTGGGCAAGTCTGTGACCACGGACGTGACGCTGGTCAACCAGGAAGAGAAGGAGGTCGTGATCGCCGACACATTCCGCGACCAGGGCGTTGTCTTCTTC
ATGTACCCTCGTGCCAACACGCCCGGCTGCACCAAACAAGCCTGTG
GTGCGTCCGTGGAAAGATTCCCAGCCTTTAAGATTTGCTCATTATGTTAAACCAACCAAAACACTCACCCTGCT
TTTGTGTAGGCTTCCGAGACAACATCCAGACCATCAAGGACGCGGGTTTCACGGTCTACGGACTAAGCGGTGACTCGCCCAAGTCTTTGACCAACTGGAAGACTAAGCAGAGTCTGCCCT
TCGATCTACTAAGTGACCCGGAGCACAAGCTCATCTCGTACTTTGGCAGTTCACTGCCTGGCAACAAGGTGCAGCGATCGCACGTCGTCATTCTTAAGGGAGGCGTTGTGGGCGATATCG
CCGCCAAGGTCTCTCCTGCTGACAGCGTCAGCCGCGCTGTCGAGTTTGTCAAGAAGAGCAGCGGTGCAGAGGCCCCCAAGGAAGATGAACCTACCAAAGAGGAGGAGCCCACGGACACCG
AGAAGTTCGCTGTGGGCAACACTGTGACCTTCGACGGCGAGCTGCAGACGGACGCCTCGGCTACGGTCAAGGTCCAGGATCTGTTCAAGACCCGCGGCGCCATCTTCTTCATGTACCCGA
AGGCAGACACGCCCGGTTGCACCACTCAGGCGTGCGGATACAACGACAACCTGGAGGCGATCAACGCCGCCGGATTCGACGTGTACGGCCTGGGCGCGGATACCCCCGCCGAGCTTCTCG
CGTGGAAGGAGTCGCAGAAGTACAAGTACACATTCTTGTCGGATCCGAAGCACCAGCTTATCGGCTACTTCGGCAGCTCCATCAACGATGGCACGCGTGTGGAGCGCTCGCACGTGATCG
TGCTACCCGGCGGTAAAGTGGGCCAGATCGAACACAACATTTCGCCGCAGGACAGCGTGAGCAAGGGCCTCGAATTCGCCAAGAGCCACACCATCGACGCTGCCAGCAAGTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGTCCACTCGCAGCCGCACGAACTCGGGCTCGTCATCCGCCGCTGAGCTGCCGCAGAAGCGCTCGGCCACCGCAGATGCGTCCAAACGCCCGGCCAAGAAGCCCACGACGCCCAAG
GCCGCCGCCAGCGATCTGGCCGTGGGCAAGTCTGTGACCACGGACGTGACGCTGGTCAACCAGGAAGAGAAGGAGGTCGTGATCGCCGACACATTCCGCGACCAGGGCGTTGTCTTCTTC
ATGTACCCTCGTGCCAACACGCCCGGCTGCACCAAACAAGCCTGTG
GCTTCCGAGACAACATCCAGACCATCAAGGACGCGGGTTTCACGGTCTACGGACTAAGCGGTGACTCGCCCAAG
TCTTTGACCAACTGGAAGACTAAGCAGAGTCTGCCCTTCGATCTACTAAGTGACCCGGAGCACAAGCTCATCTCGTACTTTGGCAGTTCACTGCCTGGCAACAAGGTGCAGCGATCGCAC
GTCGTCATTCTTAAGGGAGGCGTTGTGGGCGATATCGCCGCCAAGGTCTCTCCTGCTGACAGCGTCAGCCGCGCTGTCGAGTTTGTCAAGAAGAGCAGCGGTGCAGAGGCCCCCAAGGAA
GATGAACCTACCAAAGAGGAGGAGCCCACGGACACCGAGAAGTTCGCTGTGGGCAACACTGTGACCTTCGACGGCGAGCTGCAGACGGACGCCTCGGCTACGGTCAAGGTCCAGGATCTG
TTCAAGACCCGCGGCGCCATCTTCTTCATGTACCCGAAGGCAGACACGCCCGGTTGCACCACTCAGGCGTGCGGATACAACGACAACCTGGAGGCGATCAACGCCGCCGGATTCGACGTG
TACGGCCTGGGCGCGGATACCCCCGCCGAGCTTCTCGCGTGGAAGGAGTCGCAGAAGTACAAGTACACATTCTTGTCGGATCCGAAGCACCAGCTTATCGGCTACTTCGGCAGCTCCATC
AACGATGGCACGCGTGTGGAGCGCTCGCACGTGATCGTGCTACCCGGCGGTAAAGTGGGCCAGATCGAACACAACATTTCGCCGCAGGACAGCGTGAGCAAGGGCCTCGAATTCGCCAAG
AGCCACACCATCGACGCTGCCAGCAAGTTGTAA

Retrieve as FASTA