Entry information : CrubPrx12 (Carubv10020541m.g)
Entry ID 12893
Creation 2014-03-17 (Maxime Neel)
Last sequence changes 2014-03-17 (Maxime Neel)
Sequence status complete
Reviewer Maxime Neel
Last annotation changes 2014-03-18 (Maxime Neel)
Peroxidase information: CrubPrx12 (Carubv10020541m.g)
Name (synonym) CrubPrx12 (Carubv10020541m.g)
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Capsella
Organism Capsella rubella    [TaxId: 81985 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CrubPrx12
start..stop
S start..stop
AhalPrx49 716 0 1..358 1..358
BstrPrx46 706 0 1..358 1..360
AlyPrx12 705 0 1..355 1..355
AtPrx12 704 0 1..358 1..358
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10492960..10493226 267 N° 2 10494285..10494479 195 N° 3 10494625..10495239 615  
join(10492960..10493226,10494285..10494479,10494625..10495239)


exon

Literature and cross-references CrubPrx12 (Carubv10020541m.g)
DNA ref. Phytozome 12:   scaffold_2 (10492960..10495239)
Protein sequence: CrubPrx12 (Carubv10020541m.g)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   359 (327)
PWM (Da):   %s   39322.13 (35883.3) Transmb domain:   %s   o5-27i
PI (pH):   %s   8.39 (8.21) Peptide Signal:   %s   cut: 32 range:32-358
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKGYSTRVLTFLMLISLMAVTLNLVSTAEAKKRRRDAPIVQGLSWNFYQKACPKVENIIRKELKKVFKRDIGLAAAILRIHFHDCFVQGCEASVLLAGSASGPGEQSSIPNLTLRQQAFVVIDNLRALVQKRCGQVVSCSDVLALAARDSVVLSGGPDYAVPLGRRDSLAFASQETTLNNLPPPFANASQLIADFANRNLNITDLVALSGGHTIGIAHCPSFTDRLYPNQDPTMNKAFANNLKRTCPTANSSNTQVNDIRSPDVFDNKYYVDLMNRQGLFTSDQDLFVDKRTRGIVESYAIDQQLFFDHFTVAMIKMGQMSVLTGTQGEIRSNCSARNTPSFMSVLEEGIEEAISII*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AATGACAATT GTCACGAGAC AAACATTGCA GCTCTTTTAA GAATAATTAG GTGGTGTGAC AAAAATTGAA TAGAAGACAT TAAGTGAGTA GCAATAATGC AACTTAAAAA AATATATCTC  GGCCACCCTG TTCAATTTCA AGGTTTGACA TGGATAGGGG CCAAAGTATA ATTGTATGAA TCTCTATGAG AGGAGATTTA TGTATTGATC ACATATATAT ATATATATGG TATGTGTGTG  ATAAGATTGT ATCATTTTAG CTCGATGAAG GATGTCCGAT GCATAATTTT GCTGATTAAG AAATGTACCT TTCGGATTGC GCAGGATAGA TATACGGAGT GATCTTAGAT CTGTCATGGC  AAAGGCAGAA TTAATCAAGG GTGGAGATCT AATCAAGGAG AGCCGGCGAG GATGCGGTGA GAGCAATGTC ATCAACATAA AGAAGCAAAT ACGCAATATC CCTGCCACGA GAAAAAACAA  ACAGCTACGA GGCCGAAACA CTTTGAATAA AACCAAGTCG CTTAGCAAAC ATGGAGAACC TTGTATACCA TGTGTGTGGT GCTTGTTTTC AATCACGTGC TCGCTTTGCA TTAGATTTTC  AAAACTTGGA GAAAGTCTGT TCGCTCTTTT GGGTTGATTT CAAATACCCC ACCATTTCTG CTAAAGTCGC AATCTTCATA AACCATTAAT TTACGATCCA CTGACCCAAA CGAATTTGCC  AACACAAACA CGCGTGCTTG TCTTGAATTT CGTCCACTGT CAATTGTCAT GCGAGTTTCT TTCTACAAAA AAAAATCCAC ATCGATACTT TCTTTACAGA AATGGATCAA ATCACTTTTT  GGGACTCTAA TTAGACCAAT AACTAGTAAA CACAACTTAA TATGAAATTT TAGATTACTT TCGATATATA GTTGTCTGTC GCTAGAGGCT AATTAATAAT GCTATCAGAC TATCATACAC  CACAATATAT AGAGTATGTA CAAGTGTACT ATCCAAGACC CATAGATGGG CTATGATATT ATTTTGACGG TGATCTCATT TATGACTTTT AGATTCTTCT ACACTAGGCT TTTTGACTTT  TGTTGGTTGT TGCTGCGGAA CGCAGTTTCT CGTCATATTA TAATCTCCGG TCTCCGCGTC CATAACAATC CAAATCGCAT GCACGCGACT AATAAATAAC TCGTGTATAT ATATTATACT  CCAAAACTAC TTCTAATTGT CAAATTAATA TAGCACAACA TATATCATAC TATGCTTAGT ATTTTTCTTA AGAATATTTC TTTTTCATAT ATAGAAAGTT CCGGGCATTA TTTTCATAGT  AGCGAAGACG TAGTATTTTG ATCATGCTTA GGGAAGGACC GTAAAGAATC CTCTCTCTAA ACATAGAACA TGGAATTTGA GTTCGGGCTT TATGATAAAT AGCACTAAAA CAATTCCTTG  AACAGGTTTA AGTAATCGAA AATTGTACAC GGAAAAACAA TCAACGTTTT CAATTTTACT CTAATTAATA GTAGTACTAT TTATATCCAT TGTCAATAGT CAAGTTGATA TAGTAATATA  AACCCCACAC GTATTTATCT CCTTTATCTT TAGGAAAAAA GAAAATATTT ATATGCTTTA ATATTTGATC CAAAAACTAC AAAGTCTATG TATATATTTT TTTTGGTCAT CATATCAAAA  ATGGGATTGT GTTAAATAAT TGACACGTTA ATTACATACG GGGGACGAGA CCCGTTCCTA CGATCAAAAC ACAAACTTTC CTCGCAGTTT TGTTTTTTTT TTTGTTTTTT TGGTCTTTTG  GAAATAATAA AAAGGGAAAA TTTGCGTTTT ATTAAATATA TATGGAAGGA GGAAGCTTTA AACCTAAATA AGCTAAACAA GGACCACATT TGCCTATAAA AACAAAGTCC ATATAGTATT 
TCCCAAGAAC AAGAAAAAGC AGAGAAGATA GAGAAAGAGA GAGTGAGAGG GTTTGATTGA GAAACAAACA CCAAAAAAAA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAAGGGTTATTCGACACGTGTGCTCACGTTTCTGATGTTGATCTCGCTAATGGCGGTGACACTGAATCTTGTGTCTACTGCGGAGGCAAAGAAGCGGAGGAGAGATGCCCCTATA
GTGCAAGGTCTCTCATGGAACTTTTACCAGAAAGCATGTCCCAAAGTCGAAAACATTATCAGAAAAGAGCTCAAGAAAGTCTTCAAGAGAGATATTGGTTTGGCCGCAGCCATCCTTCGT
ATACATTTCCATGATTGCTTCGTTCAG
GTTCCATATCTTTCTTCTTCTTCCTTTTGTTTTTTTTTTTCTTTGTATTAAAACCAAAGAAAACTTAATCTGATTCTTTAAGCCTACTCGAAA
CGGTTCTACTTATGTAATCTGATTCTTTCTTTTCGAAAAAAGGAATCTCGGTTTTAGAGTACTGTATAACTCATTATACCCACACAATAAAAAAAAAAAAATTCGGGTTGTGGTACTTTT
GTTTTTAAAATCCGACCAAAATAACCTTAAAGAAAAACACAACATCGCCTCGAAATTCTCAGGAACAAGATAAAGAGTTGTCCGCTTCTTACTTTCACAATTTTTGTTTTTTTCAAACAT
AAAAAAATATGACCAAACATACCATTGAATAGTGTTGTACTGTTGTTTAATACTGCTACAAACTATTACATTAATATTACAATATAAGTATAGTTTCTACCCTTTGCCCAAAAAAAAAAG
GTATAGTTTCTACCCCAAAAAATAAAAATAATTAAAATAATACATTACATGCAATAGGATCGATAGACCGATAGAGAGAGTTGAAGATAGAGGGACATGTCGCATTAATACTATTCACCG
GCTTTCCGTAGGTTAGTTGGATCTCAGTTATGGAACATGCATATATATCTTAAACAATTACATTTCTAACTATTGATAAGAAAAACAAAGAAGTTATGATGAGAAAAAATATATTCAAGA
TTAGAATAGCATGTACAACAAATTCAGCACATGCATGTATGTGAATTATATAGTTGAATATGACTATTAATTTGATGTATTTAAATTTCTGTTGAAAAATATCTGATATTCCTCTTTAGC
CAAATACTAAACAGAATTTGTTTTGCACTTTGCTGCAATACTATTCAGACATTTACACCTTTATAGTGTTACCTTCAAATTGCAGACTTATATATACTTCAAACATTACTTAAAATTTGT
TAATAATTATGGAAAGTGGCATAGTTTTGATCAGATCAGATAAATATATAATATTTAGGAGAAAAGATTTCTGAATGTATTTATATTATTTATGTTTGGTAAAATAAATGTCATGAGAAA
AACAGGGATGTGAAGCATCAGTGCTGCTAGCTGGATCAGCTAGTGGACCAGGAGAACAATCATCGATCCCTAACCTGACGCTCCGTCAACAAGCCTTTGTCGTCATCGATAATCTTCGTG
CCCTTGTCCAGAAAAGGTGCGGTCAAGTCGTCTCTTGCTCTGACGTCCTCGCTCTCGCCGCTCGCGACTCCGTCGTCCTT
GTAACCAACTCTCTCTTTTTCTTTCCATTACTCAATCACA
TTGCTTTCAACTTAATACTCGCGGTCACGCTAATACAAACTATATATTAGACTACAAGTCTCACTAATTCTAATTGATAGTTTTTTTTTGGGTGTGTCAATGTAGTCAGGAGGGCCAGAC
TATGCTGTGCCACTTGGGCGACGCGACTCACTAGCATTCGCGAGCCAGGAGACCACATTAAATAACTTACCACCACCCTTCGCCAACGCGAGTCAGCTCATAGCCGACTTCGCCAACAGA
AACCTTAACATAACCGACTTAGTGGCACTTTCTGGTGGTCACACCATCGGAATCGCGCATTGTCCTTCTTTCACAGACCGACTCTACCCGAACCAAGACCCAACCATGAACAAAGCCTTC
GCCAACAACCTCAAACGCACTTGTCCCACCGCGAACTCGAGCAACACCCAAGTGAATGACATAAGGAGTCCTGACGTGTTCGACAACAAGTACTACGTTGATCTCATGAACCGACAAGGG
CTATTCACTTCCGACCAAGATCTTTTCGTAGACAAGAGGACACGTGGCATCGTGGAGAGTTATGCGATCGACCAGCAGCTGTTTTTCGATCATTTCACGGTAGCGATGATCAAGATGGGT
CAGATGAGTGTCTTGACGGGAACACAAGGAGAAATTCGTTCCAACTGCTCAGCAAGAAACACCCCAAGTTTCATGTCCGTCTTGGAAGAAGGCATTGAGGAAGCTATTTCCATTATATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAAGGGTTATTCGACACGTGTGCTCACGTTTCTGATGTTGATCTCGCTAATGGCGGTGACACTGAATCTTGTGTCTACTGCGGAGGCAAAGAAGCGGAGGAGAGATGCCCCTATA
GTGCAAGGTCTCTCATGGAACTTTTACCAGAAAGCATGTCCCAAAGTCGAAAACATTATCAGAAAAGAGCTCAAGAAAGTCTTCAAGAGAGATATTGGTTTGGCCGCAGCCATCCTTCGT
ATACATTTCCATGATTGCTTCGTTCAG
GGATGTGAAGCATCAGTGCTGCTAGCTGGATCAGCTAGTGGACCAGGAGAACAATCATCGATCCCTAACCTGACGCTCCGTCAACAAGCCTTT
GTCGTCATCGATAATCTTCGTGCCCTTGTCCAGAAAAGGTGCGGTCAAGTCGTCTCTTGCTCTGACGTCCTCGCTCTCGCCGCTCGCGACTCCGTCGTCCTT
TCAGGAGGGCCAGACTAT
GCTGTGCCACTTGGGCGACGCGACTCACTAGCATTCGCGAGCCAGGAGACCACATTAAATAACTTACCACCACCCTTCGCCAACGCGAGTCAGCTCATAGCCGACTTCGCCAACAGAAAC
CTTAACATAACCGACTTAGTGGCACTTTCTGGTGGTCACACCATCGGAATCGCGCATTGTCCTTCTTTCACAGACCGACTCTACCCGAACCAAGACCCAACCATGAACAAAGCCTTCGCC
AACAACCTCAAACGCACTTGTCCCACCGCGAACTCGAGCAACACCCAAGTGAATGACATAAGGAGTCCTGACGTGTTCGACAACAAGTACTACGTTGATCTCATGAACCGACAAGGGCTA
TTCACTTCCGACCAAGATCTTTTCGTAGACAAGAGGACACGTGGCATCGTGGAGAGTTATGCGATCGACCAGCAGCTGTTTTTCGATCATTTCACGGTAGCGATGATCAAGATGGGTCAG
ATGAGTGTCTTGACGGGAACACAAGGAGAAATTCGTTCCAACTGCTCAGCAAGAAACACCCCAAGTTTCATGTCCGTCTTGGAAGAAGGCATTGAGGAAGCTATTTCCATTATATAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCACATTTGC CTATAAAAAC AAAGTCCATA TAGTATTTCC CAAGAACAAG AAAAAGCAGA GAAGATAGAG AAAGAGAGAG TGAGAGGGTT TGATTGAGAA ACAAACACCA AAAAAAAATG  GCAAAGGGTT ATTCGACACG TGTGCTCACG TTTCTGATGT TGATCTCGCT AATGGCGGTG ACACTGAATC TTGTGTCTAC TGCGGAGGCA AAGAAGCGGA GGAGAGATGC CCCTATAGTG  CAAGGTCTCT CATGGAACTT TTACCAGAAA GCATGTCCCA AAGTCGAAAA CATTATCAGA AAAGAGCTCA AGAAAGTCTT CAAGAGAGAT ATTGGTTTGG CCGCAGCCAT CCTTCGTATA  CATTTCCATG ATTGCTTCGT TCAGGGATGT GAAGCATCAG TGCTGCTAGC TGGATCAGCT AGTGGACCAG GAGAACAATC ATCGATCCCT AACCTGACGC TCCGTCAACA AGCCTTTGTC  GTCATCGATA ATCTTCGTGC CCTTGTCCAG AAAAGGTGCG GTCAAGTCGT CTCTTGCTCT GACGTCCTCG CTCTCGCCGC TCGCGACTCC GTCGTCCTTT CAGGAGGGCC AGACTATGCT  GTGCCACTTG GGCGACGCGA CTCACTAGCA TTCGCGAGCC AGGAGACCAC ATTAAATAAC TTACCACCAC CCTTCGCCAA CGCGAGTCAG CTCATAGCCG ACTTCGCCAA CAGAAACCTT  AACATAACCG ACTTAGTGGC ACTTTCTGGT GGTCACACCA TCGGAATCGC GCATTGTCCT TCTTTCACAG ACCGACTCTA CCCGAACCAA GACCCAACCA TGAACAAAGC CTTCGCCAAC  AACCTCAAAC GCACTTGTCC CACCGCGAAC TCGAGCAACA CCCAAGTGAA TGACATAAGG AGTCCTGACG TGTTCGACAA CAAGTACTAC GTTGATCTCA TGAACCGACA AGGGCTATTC  ACTTCCGACC AAGATCTTTT CGTAGACAAG AGGACACGTG GCATCGTGGA GAGTTATGCG ATCGACCAGC AGCTGTTTTT CGATCATTTC ACGGTAGCGA TGATCAAGAT GGGTCAGATG  AGTGTCTTGA CGGGAACACA AGGAGAAATT CGTTCCAACT GCTCAGCAAG AAACACCCCA AGTTTCATGT CCGTCTTGGA AGAAGGCATT GAGGAAGCTA TTTCCATTAT ATAAATAACC  ATAAATCTTC ACCTTTCTTC TTAACTCTGT TTTTATTTCG TTCACGCACT TGTGCATGGT TTGTCGAATG CTTAAAACTA TCTGATAAAT AAGAGCATTG CTTCACTTAT AACTATGTTT 
TTTAGTTCAC GCACTTGTGG TTTGACCAAT GTTTAAGATT TAAGAATACC ATCTTATGAA TAAACTAACG TATTAGTTTC TGC 

Retrieve as FASTA