Entry information : AtaPrx03
Entry ID 12899
Creation 2014-03-20 (Maxime Neel)
Last sequence changes 2014-04-22 (Christophe Dunand)
Sequence status theoretical translation / pseudogene
Reviewer Not yet reviewed
Last annotation changes 2014-04-22 (Christophe Dunand)
Peroxidase information: AtaPrx03
Name AtaPrx03
Class Class III peroxidase     [Orthogroup: Prx007]*
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Aegilops
Organism Aegilops tauschii    [TaxId: 37682 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtaPrx03
start..stop
S start..stop
HvPrx101 557 0 1..361 1..359
HvPrx14 555 0 31..336 50..355
TaPrx102-1D 548 0 27..361 22..358
AtaPrx102-D 548 0 27..361 22..358
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 161901..162155 255 N° 2 162243..163076 834  
join(161901..162155,162243..163076)


exon

Literature and cross-references AtaPrx03
Protein ref. GenBank:   EMT17421.1 UniProtKB:   N1R3X3
DNA ref. GenBank:   KD534824.1 (161901..163076)
Protein sequence: AtaPrx03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362 (339)
PWM (Da):   %s   38773.9 (36728.7)  
PI (pH):   %s   7.99 (7.71) Peptide Signal:   %s   cut: 24 range:24-362
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARGAPLLAAAVVAVVALGSVGATEQEAAGLRQPPVAQGLSFEFYRQSCPRAESIVRDFFRDAVRKDIGLAAGLLRLHFHDCFVQGCDASVLLDGSATGPGEQQAPPNLTLRPSAFKAINDIRDRLERECRGAVVSCSDILALAARDSVVASGGPEYRVPLGRRDSPRFATAQDVLSVLPPPSSNVPSLLDVLRKIGLDATDLVALSGGHTVGLGHCTSFDDRLFPRPDPTMSPDFLGRLKRTCPAKGTDARTVLDVRTPNVFDNKYYVNLVNREGLFVSDQDLFTNATTRPIVERFARSQRDFFQQFGVSMVKMGQIKVLTGDQGQVRRNCSARNSGTADGLQWSSLVQTVVDAAAEGLGF*

Retrieve as FASTA  
Remarks Theroretical sequence from genomic. Sequencing error in Exon 1.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTGGCGCCCCTCTGCTTGCAGCAGCAGTGGTAGCTGTTGTGGCACTTGGGTCTGTAGGGGCGACAGAGCAGGAGGCCGCCGGCTTGAGGCAGCCTCCGGTGGCGCAGGGCCTG
TCGTTCGAGTTCTACCGGCAGAGCTGCCCCAGGGCAGAGTCCATCGTGCGTGACTTCTTCCGGGACGCCGTCCGCAAGGACATCGGCCTCGCCGCCGGCCTGCTCCGCCTCCACTTCCAC
GATTGCTTCGTGCAG
GTACGAACCTTTTCTGGCCAGCTCAGTTGATTGCCTCCCATCAACCATTAACCGGTTCATGCATGAACGCGCCGCACATGCATGCAGGGCTGTGACGCGTCGGTA
CTTCTAGACGGGTCGGCGACGGGGCCGGGGGAGCAGCAGGCGCCGCCAAACCTCACGCTCCGCCCGTCCGCCTTCAAGGCCATCAACGACATCCGTGACCGGCTGGAGCGCGAGTGCCGC
GGCGCCGTCGTCTCCTGCTCCGACATCCTCGCTCTTGCCGCCCGCGACTCCGTGGTCGCCTCGGGCGGGCCGGAGTACCGCGTGCCCCTCGGCCGCCGCGACAGCCCCCGGTTCGCCACG
GCGCAAGACGTTCTCTCAGTCCTTCCCCCGCCATCATCGAATGTGCCGTCCCTCCTGGACGTGCTCCGCAAGATCGGCCTCGACGCCACCGACCTCGTCGCGCTCTCCGGCGGCCATACC
GTGGGGCTCGGGCACTGCACCTCCTTCGACGACCGGCTCTTCCCGCGCCCGGACCCCACCATGAGCCCGGACTTCCTTGGCAGGCTGAAGCGGACGTGCCCGGCCAAGGGCACCGACGCG
CGCACCGTGCTGGACGTGCGCACCCCCAACGTGTTCGACAACAAGTACTACGTGAACCTGGTGAACCGGGAGGGGCTCTTCGTGTCCGACCAGGACCTCTTCACCAACGCCACCACCCGG
CCCATCGTGGAGCGCTTCGCGCGCAGCCAGCGCGACTTCTTCCAGCAGTTTGGTGTGTCCATGGTCAAGATGGGGCAGATCAAGGTGCTCACCGGCGACCAGGGCCAGGTTCGCCGCAAC
TGCTCCGCTCGCAACTCCGGCACTGCTGACGGCCTCCAGTGGTCGTCCCTGGTGCAGACCGTCGTCGACGCCGCCGCGGAGGGCCTCGGTTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTGGCGCCCCTCTGCTTGCAGCAGCAGTGGTAGCTGTTGTGGCACTTGGGTCTGTAGGGGCGACAGAGCAGGAGGCCGCCGGCTTGAGGCAGCCTCCGGTGGCGCAGGGCCTG
TCGTTCGAGTTCTACCGGCAGAGCTGCCCCAGGGCAGAGTCCATCGTGCGTGACTTCTTCCGGGACGCCGTCCGCAAGGACATCGGCCTCGCCGCCGGCCTGCTCCGCCTCCACTTCCAC
GATTGCTTCGTGCAG
GGCTGTGACGCGTCGGTACTTCTAGACGGGTCGGCGACGGGGCCGGGGGAGCAGCAGGCGCCGCCAAACCTCACGCTCCGCCCGTCCGCCTTCAAGGCCATCAAC
GACATCCGTGACCGGCTGGAGCGCGAGTGCCGCGGCGCCGTCGTCTCCTGCTCCGACATCCTCGCTCTTGCCGCCCGCGACTCCGTGGTCGCCTCGGGCGGGCCGGAGTACCGCGTGCCC
CTCGGCCGCCGCGACAGCCCCCGGTTCGCCACGGCGCAAGACGTTCTCTCAGTCCTTCCCCCGCCATCATCGAATGTGCCGTCCCTCCTGGACGTGCTCCGCAAGATCGGCCTCGACGCC
ACCGACCTCGTCGCGCTCTCCGGCGGCCATACCGTGGGGCTCGGGCACTGCACCTCCTTCGACGACCGGCTCTTCCCGCGCCCGGACCCCACCATGAGCCCGGACTTCCTTGGCAGGCTG
AAGCGGACGTGCCCGGCCAAGGGCACCGACGCGCGCACCGTGCTGGACGTGCGCACCCCCAACGTGTTCGACAACAAGTACTACGTGAACCTGGTGAACCGGGAGGGGCTCTTCGTGTCC
GACCAGGACCTCTTCACCAACGCCACCACCCGGCCCATCGTGGAGCGCTTCGCGCGCAGCCAGCGCGACTTCTTCCAGCAGTTTGGTGTGTCCATGGTCAAGATGGGGCAGATCAAGGTG
CTCACCGGCGACCAGGGCCAGGTTCGCCGCAACTGCTCCGCTCGCAACTCCGGCACTGCTGACGGCCTCCAGTGGTCGTCCCTGGTGCAGACCGTCGTCGACGCCGCCGCGGAGGGCCTC
GGTTTCTAA

Retrieve as FASTA