Entry information : AruPrx53-1 (HRP_A2A)
Entry ID 12911
Creation 2014-05-05 (Christophe Dunand)
Last sequence changes 2014-05-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-05-05 (Christophe Dunand)
Peroxidase information: AruPrx53-1 (HRP_A2A)
Name (synonym) AruPrx53-1 (HRP_A2A)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Armoracia
Organism Armoracia rusticana (horseradish)    [TaxId: 3704 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AruPrx53-1
start..stop
S start..stop
AruPrx53-2 665 0 1..336 1..336
AtPrx53 635 0 1..336 1..335
CagraPrx62 629 0 1..336 1..335
AlyPrx53 625 0 1..336 1..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 40..273 234 N° 2 366..557 192 N° 3 725..890 166 N° 4 967..1385 419
join(40..273,366..557,725..890,967..1385)


exon

Literature and cross-references AruPrx53-1 (HRP_A2A)
Protein ref. UniProtKB:   K7ZW28
DNA ref. GenBank:   HE963806.1
Protein sequence: AruPrx53-1 (HRP_A2A)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (305)
PWM (Da):   %s   34920.21 (31778.6) Transmb domain:   %s   i13-35o
PI (pH):   %s   4.62 (4.74) Peptide Signal:   %s   cut: 32 range:32-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVTNLSTTCDGLFIISLLVIVSSLFGTSSAQLNATFYSGTCPNASAIVRSTIQQAFQSDTRIGASLIRLHFHDCFVNGCDASILLDDSGSIQSEKNAGPNANSARGFNVVDNIKTALENTCPGVVSCSDILALASEASVSLTGGPSWTVLLGRRDSLTANLAGANSAIPSPFEGLSNITSKFSAVGLNTNDLVALSGAHTFGRARCGVFNNRLFNFSGTGNPDPTLNSTLLSSLQQLCPQNGSASTITNLDLSTPDAFDNNYFANLQSNNGLLQSDQELFSTTGSATIAVVTSFASNQTLFFQAFAQSMINMGNISPLTGSNGEIRLDCKKVNGS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Variant of HRP_A2B.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTAACAAATCTATCTACTACTTGTGATGGTTTGTTTATCATCAGCCTTCTTGTTATCGTTTCTTCATTGTTTGGAACATCATCTGCGCAGCTAAATGCAACGTTTTACTCCGGG
ACTTGCCCTAACGCATCTGCCATCGTACGCAGCACTATTCAGCAAGCTTTTCAATCCGATACAAGAATCGGAGCCAGCCTCATCCGCCTTCATTTTCACGACTGCTTTGTTAAT
GTATAC
TAATCTTCCCAATGCAGCTCTTTACATAAAGGCTTCTTGATATTTTTCGCTCTAAACCGCTACTTTGCTTCTTTATTTTTTCAAAGGGTTGTGATGCGTCGATCTTGCTTGACGACAGTG
GAAGCATCCAGAGCGAGAAGAACGCTGGTCCGAATGCAAACTCAGCTAGAGGATTCAATGTTGTCGATAACATCAAGACTGCCCTTGAAAACACTTGCCCTGGTGTTGTCTCTTGCTCTG
ACATTTTAGCCCTTGCCTCAGAGGCTTCCGTGTCTTTG
GTAATTAGTAATTACACTTTCTTTGTGAACATATGAAACAAAACATAACTAAAAATTTCAAATTTGCTCTTAATTTCTTGTT
ATATATATATAATTTGTCTTATAAATTATGTTTTAGTAATAATATAGATACGTATATGTTCATATATATGTTTGATCATCTTCAGACAGGAGGGCCATCATGGACTGTATTATTAGGAAG
ACGAGATAGTCTCACCGCAAACCTCGCCGGGGCAAATTCGGCTATTCCTTCTCCCTTCGAAGGCCTTAGCAATATCACATCTAAATTTTCGGCTGTCGGGCTAAACACGAACGATCTAGT
AGCCTTATCTG
GTAAGTTCATCTACATGTTTAGTTACTTGCGGTTCAAGTTAATTCAAAACCCTGACGTCATCTCTTGTCTACGTAGGTGCGCATACGTTCGGGCGTGCTCGATGTGGAG
TGTTCAACAACAGACTATTTAACTTCAGCGGGACAGGAAATCCAGACCCGACTCTAAACTCAACGCTACTGAGCAGTCTTCAACAGCTATGTCCTCAAAACGGCAGCGCATCAACCATCA
CCAATCTCGATCTGAGCACACCTGATGCGTTCGATAACAATTACTTCGCCAACCTTCAGAGCAACAATGGGCTTCTTCAGTCAGACCAAGAGCTGTTCTCTACCACGGGTTCAGCCACAA
TAGCGGTTGTTACCTCCTTTGCAAGTAACCAGACTCTGTTTTTTCAGGCCTTTGCTCAGTCCATGATCAACATGGGGAATATTAGTCCCTTGACAGGGAGTAATGGAGAGATTAGATTAG
ACTGTAAGAAGGTTAATGGAAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTAACAAATCTATCTACTACTTGTGATGGTTTGTTTATCATCAGCCTTCTTGTTATCGTTTCTTCATTGTTTGGAACATCATCTGCGCAGCTAAATGCAACGTTTTACTCCGGG
ACTTGCCCTAACGCATCTGCCATCGTACGCAGCACTATTCAGCAAGCTTTTCAATCCGATACAAGAATCGGAGCCAGCCTCATCCGCCTTCATTTTCACGACTGCTTTGTTAAT
GGTTGT
GATGCGTCGATCTTGCTTGACGACAGTGGAAGCATCCAGAGCGAGAAGAACGCTGGTCCGAATGCAAACTCAGCTAGAGGATTCAATGTTGTCGATAACATCAAGACTGCCCTTGAAAAC
ACTTGCCCTGGTGTTGTCTCTTGCTCTGACATTTTAGCCCTTGCCTCAGAGGCTTCCGTGTCTTTG
ACAGGAGGGCCATCATGGACTGTATTATTAGGAAGACGAGATAGTCTCACCGCA
AACCTCGCCGGGGCAAATTCGGCTATTCCTTCTCCCTTCGAAGGCCTTAGCAATATCACATCTAAATTTTCGGCTGTCGGGCTAAACACGAACGATCTAGTAGCCTTATCTG
GTGCGCAT
ACGTTCGGGCGTGCTCGATGTGGAGTGTTCAACAACAGACTATTTAACTTCAGCGGGACAGGAAATCCAGACCCGACTCTAAACTCAACGCTACTGAGCAGTCTTCAACAGCTATGTCCT
CAAAACGGCAGCGCATCAACCATCACCAATCTCGATCTGAGCACACCTGATGCGTTCGATAACAATTACTTCGCCAACCTTCAGAGCAACAATGGGCTTCTTCAGTCAGACCAAGAGCTG
TTCTCTACCACGGGTTCAGCCACAATAGCGGTTGTTACCTCCTTTGCAAGTAACCAGACTCTGTTTTTTCAGGCCTTTGCTCAGTCCATGATCAACATGGGGAATATTAGTCCCTTGACA
GGGAGTAATGGAGAGATTAGATTAGACTGTAAGAAGGTTAATGGAAGTTGA

Retrieve as FASTA