Entry information : AruPrx32 (HRP_1805)
Entry ID 12915
Creation 2014-06-12 (Christophe Dunand)
Last sequence changes 2014-06-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-06-12 (Christophe Dunand)
Peroxidase information: AruPrx32 (HRP_1805)
Name (synonym) AruPrx32 (HRP_1805)
Class Class III peroxidase    [Orthogroup: Prx035]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Armoracia
Organism Armoracia rusticana (horseradish)    [TaxId: 3704 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AruPrx32
start..stop
S start..stop
AtPrx32 677 0 6..354 4..352
BstrPrx67 674 0 1..354 1..352
CrubPrx101 670 0 1..354 21..372
AhalPrx29 665 0 6..354 4..352
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38..271 234 N° 2 1381..1572 192 N° 3 2095..2263 169 N° 4 2353..2822 470
join(38..271,1381..1572,2095..2263,2353..2822)


exon

Literature and cross-references AruPrx32 (HRP_1805)
Literature REFERENCE 2 Naatsaari,L., Krainer,F.W., Schubert,M., Glieder,A. and Thallinger,G.G. Peroxidase gene discovery from the horseradish transcriptome . BMC Genomics 15 (1), 227 (2014)
Protein ref. UniProtKB:   K7ZW05
Protein sequence: AruPrx32 (HRP_1805)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   354 (323)
PWM (Da):   %s   38947.42 (35604.8)  
PI (pH):   %s   6.85 (6.35) Peptide Signal:   %s   cut: 32 range:32-354
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHFSTSSSSLSTWTTLITLGCLMLHSFKSSAQLTPTFYDSTCPSVFSIVRDTIVNELRSDPRIAASILRLHFHDCFVNGCDASILLDNTTSFRTEKDAAPNANSARGFPVIDTMKAAVERACPRTVSCADLLTIAAQQSVNLAGGPSWRVPLGRRDSVQAFFDLANTNLPAPFFTLPQLKASFSNVGLDRPEDLVALSGGHTFGKNQCQFIMDRLYNFSNTGLPDPTLNTTYLQTLRVQCPRNGNQSVLVDFDLRTPTVFDNKYYVNLKEHKGLIQTDQELFSSPNAADTIPLVRSYADGTQKFFNAFMEAMNRMGNITPLTGTQGQIRQNCRVINSNSLLHDIVEIVDFVSSM

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTTCTCTACTTCTTCTTCTTCCTTGTCTACTTGGACAACCCTAATAACATTGGGGTGTCTTATGCTTCATTCATTTAAGTCCAGTGCTCAACTAACCCCTACCTTTTACGACAGT
ACCTGCCCCAGCGTCTTTAGCATCGTACGGGACACCATCGTGAACGAGCTAAGATCAGATCCTCGAATTGCTGCAAGTATCCTTCGTCTTCACTTCCACGACTGCTTCGTTAAT
GTAAGA
TATTATTTTTCAGTTTAATTGATGATTTTGTGGATACGCTAGTATCTTTTATAATTGAATAAAAGAATTATTTTATCTAATTTTCACACATATAATTGATATATTTGGTACTAATATAAG
TTCTTCAAAAACAATTTCAACGATTTGTGTTGTCAACTTAGTTGCAATTCGGATCGACTTGTAGTTAACGTATTTGTTTTCTGAAATAAGTTTTTTGGGTGGGGATAATGGCGCCACTCA
AGAAAAACCAGTTATTTCTTTGTAAGTTTTAATTGTTGAGAAAGACAACAAAAAAAAACGCGTGGATACGGCACTTACATTTATTAAACTAAAGGTTTGTCAGAATTAATTAATTATAGT
AATAGTTGTTTCTGTGGTATTAGTTTTTTTGTTTGTTAAAGCGTTTCTGTGGTATTAGTTACCATGACATGTTATCATCAATACAAAAGTTCACGTAGTTAGATGTAATATTTTTGGTTT
TTACTGTCGAGTATTTTTCTTCTTGTCGTCGACTCATGACATAAAATAATGATTCCAAAACATCTATTAAACTTTGACCTCCCATTCGGCGAACATGAATTATTCGTACAATAATTTAAT
AAAAGCATGGACCCGTACAAAGCACGTTATGAAAATTTAAATCAGTCCCTTTTTTTAGCATAAAAATAATTTTTTTTGTGAAATCATTGAAAAGTCTCAAGCTTATCCTCAACCCCAAAT
AACCTACAGATATGAAAAAGAAACAGAAATGTACGTCAAAACCTACTATATAATTTAATTTATTATTTTTGGGATTTTCAACTCTCGAATCTGATGTAGTTGTTAGCATACTTTATTTGA
ACTTTTAATGTTTTTATTCGAAAACATAGTATATACCCAGACCCAGATATTATAGCCAAATAATGTAGACCAACAACTTTTTGAATTTTGTGTGAAAAGATTTTAGATTTATATGTAAAC
TAATCTGTTTATAATTATGTATATATTATCATGCCTTGTTGAAGAGGAACAAATGGTTTCAAGGAATGAAAATGCAATCTAACAATGTTTATAGGTAGTAATTAAAGATTTGATTATGAT
TTCAACTTATTTCTTTGCAAAAGGGCTGTGATGCATCGATTTTGTTAGACAACACAACATCATTTCGAACAGAGAAAGATGCAGCTCCAAACGCAAACTCAGCTCGAGGATTTCCAGTGA
TTGATACAATGAAAGCTGCAGTGGAAAGAGCATGTCCAAGAACCGTATCATGCGCAGATTTGCTTACCATCGCAGCTCAACAATCTGTGAATTTG
GTATGCAACATTAATTTATCTCTTT
TTTTTAGTTTTAATTTTATCTATTTTTTCTCCACTTCTTGCAAACATGGTCTCAAATTCCTTGTTGAAGCCGTAACTGAACCCGTTAAACATGACTACATAGCATTGAAAAATGAGATGG
ACTGTTGCATGTTTTATAATTTAGATTTAATATTACCATTCTTAAATATTAATTACCATACTTGTCTTGAAAATTCATTGTAAGAAATAATCAAAAACACATGGTAATAATATTGTCTTG
TTTTTGTAAAAGGGTTGGGTTTTCTAATAATATAAAGTCTCATTACAATAATAAACTTGATTAGATAAAAACTCTTTTCTGAATTAACTAAAGTGAATATAAGCAATATTTGTAAAAGAA
CTGGGAAAATAACAGTACAATTGAGAACCTAATTTTGGGATTTATATTTTATATATCCTTTTTAATAATTATGACTTTGACGTGGTAAGAATTATTTTCATCTATAAAATCATTATTTTA
AGATATGGGTATTTTAGGCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGGAGAAGAGACAGCGTACAAGCATTTTTTGATCTTGCCAATACAAATCTTCCCGCTCCATTCTTCACGCTTC
CACAACTTAAGGCCAGCTTTAGTAATGTTGGACTTGACCGTCCAGAAGATCTCGTTGCACTCTCTG
GTAATTATGAGGAGTAATAGTAACAACCAAAACTTTTATTTGATCTAATTAGTT
TATAAAATATTATTAATTTATCATCTTTTGATTAGGTGGTCACACATTTGGTAAAAACCAATGCCAATTTATTATGGACAGACTATACAACTTTAGTAACACTGGTTTACCCGACCCTAC
TCTCAACACTACTTATCTCCAGACACTTCGTGTACAATGTCCCCGTAATGGTAACCAGTCCGTCTTGGTCGATTTCGATCTACGCACACCGACAGTTTTTGACAACAAATACTATGTGAA
TCTGAAAGAGCACAAGGGACTTATCCAGACCGATCAAGAGTTGTTCTCCAGCCCTAATGCCGCTGATACAATCCCCTTGGTAAGATCATATGCTGATGGCACTCAGAAGTTCTTCAATGC
TTTTATGGAGGCCATGAACAGAATGGGAAACATTACCCCTCTCACTGGAACTCAAGGACAGATCAGGCAAAATTGTAGGGTGATCAACTCCAACTCGCTGCTCCATGATATTGTTGAAAT
CGTTGACTTTGTGAGCTCTATGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTTCTCTACTTCTTCTTCTTCCTTGTCTACTTGGACAACCCTAATAACATTGGGGTGTCTTATGCTTCATTCATTTAAGTCCAGTGCTCAACTAACCCCTACCTTTTACGACAGT
ACCTGCCCCAGCGTCTTTAGCATCGTACGGGACACCATCGTGAACGAGCTAAGATCAGATCCTCGAATTGCTGCAAGTATCCTTCGTCTTCACTTCCACGACTGCTTCGTTAAT
GGCTGT
GATGCATCGATTTTGTTAGACAACACAACATCATTTCGAACAGAGAAAGATGCAGCTCCAAACGCAAACTCAGCTCGAGGATTTCCAGTGATTGATACAATGAAAGCTGCAGTGGAAAGA
GCATGTCCAAGAACCGTATCATGCGCAGATTTGCTTACCATCGCAGCTCAACAATCTGTGAATTTG
GCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGGAGAAGAGACAGCGTACAAGCA
TTTTTTGATCTTGCCAATACAAATCTTCCCGCTCCATTCTTCACGCTTCCACAACTTAAGGCCAGCTTTAGTAATGTTGGACTTGACCGTCCAGAAGATCTCGTTGCACTCTCTG
GTGGT
CACACATTTGGTAAAAACCAATGCCAATTTATTATGGACAGACTATACAACTTTAGTAACACTGGTTTACCCGACCCTACTCTCAACACTACTTATCTCCAGACACTTCGTGTACAATGT
CCCCGTAATGGTAACCAGTCCGTCTTGGTCGATTTCGATCTACGCACACCGACAGTTTTTGACAACAAATACTATGTGAATCTGAAAGAGCACAAGGGACTTATCCAGACCGATCAAGAG
TTGTTCTCCAGCCCTAATGCCGCTGATACAATCCCCTTGGTAAGATCATATGCTGATGGCACTCAGAAGTTCTTCAATGCTTTTATGGAGGCCATGAACAGAATGGGAAACATTACCCCT
CTCACTGGAACTCAAGGACAGATCAGGCAAAATTGTAGGGTGATCAACTCCAACTCGCTGCTCCATGATATTGTTGAAATCGTTGACTTTGTGAGCTCTATGTAA

Retrieve as FASTA