Entry information : AruPrx47 (HRP_6351)
Entry ID 12919
Creation 2014-06-12 (Christophe Dunand)
Last sequence changes 2014-06-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-06-12 (Christophe Dunand)
Peroxidase information: AruPrx47 (HRP_6351)
Name (synonym) AruPrx47 (HRP_6351)
Class Class III peroxidase    [Orthogroup: Prx026]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Armoracia
Organism Armoracia rusticana (horseradish)    [TaxId: 3704 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AruPrx47
start..stop
S start..stop
AtPrx47 630 0 1..314 12..325
AlyPrx47 627 0 1..314 12..325
CrubPrx54 623 0 1..314 12..325
CagraPrx66 622 0 1..314 12..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..213 213 N° 2 317..505 189 N° 3 603..765 163 N° 4 1468..1847 380
join(1..213,317..505,603..765,1468..1847)


exon

Literature and cross-references AruPrx47 (HRP_6351)
Literature REFERENCE 2 Naatsaari,L., Krainer,F.W., Schubert,M., Glieder,A. and Thallinger,G.G. Peroxidase gene discovery from the horseradish transcriptome . BMC Genomics 15 (1), 227 (2014)
Protein ref. UniProtKB:   K7ZW31
DNA ref. GenBank:   HE963816.1
Protein sequence: AruPrx47 (HRP_6351)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314 (289)
PWM (Da):   %s   34500.04 (31742.5) Transmb domain:   %s   i5-23o
PI (pH):   %s   7.31 (5.87) Peptide Signal:   %s   cut: 26 range:26-314
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVRANLVSVILLMHVIVGFPFHARGLSMTYYMMSCPMAEQIVKNSVNNALQADPTLAAGLIRMLFHDCFIEGCDASILLDSTKDNTAEKDSPANLSLRGYEIIDDAKEKVENMCPGVVSCADIVAMAARDAVFWAGGPYYDIPKGRFDGKRSKIEDTRNLPSPFLNASQLIQTFGNRGFSPQDVVALSGAHTLGVARCSSFKARLTTPDSSLDSTFANTLTRTCNAGDNAEQPFDATRNDFDNAYFNALQRKSGVLFSDQTLFNTPRTRNLVNGYALNQAKFFFDFQQAMRKMSNLDVKLGSQGEIRQNCRTIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTAGGGCAAATTTAGTGAGCGTGATTCTGTTAATGCATGTTATTGTTGGGTTTCCTTTTCATGCGAGGGGCTTAAGTATGACTTATTACATGATGAGCTGTCCTATGGCTGAACAA
ATTGTGAAAAACAGTGTTAACAATGCTCTTCAAGCCGATCCCACTTTAGCCGCAGGTCTTATACGTATGTTGTTCCACGACTGTTTCATTGAG
GTATAGTAATGTTTTTTTTTCTTTTCT
TAATTAGTTTCCAATATTCTAATTGTGTCGTTTACGTAGAGAACCCCTTAAATTAGTTATTTTTGGTCTTATTAAGGGATGTGATGCGTCGATTCTGCTAGATTCAACAAAAGACAACAC
TGCGGAAAAGGATTCTCCTGCGAATCTGAGTCTACGTGGCTACGAGATCATAGATGATGCAAAAGAGAAAGTTGAGAATATGTGTCCAGGAGTTGTATCTTGCGCAGATATTGTTGCCAT
GGCTGCTAGAGATGCTGTCTTTTGG
GTAATTATATAAGCTGATCAAAATTGACATTGTGATTACATTAAGATAATCTTTTTAATTACTTAATATAATTACTAGTGATTGGTTTGTTGATT
AGGCTGGTGGTCCATATTATGACATACCAAAAGGAAGATTTGATGGTAAAAGATCGAAGATAGAAGATACAAGAAACCTTCCTTCACCTTTTCTCAATGCCTCTCAACTCATTCAAACCT
TTGGCAACCGTGGCTTCTCTCCGCAAGATGTTGTTGCTCTCTCTG
GTGAGTTCTTTACTACATACGTACTTGGATTCCGTATATGTCGATATTTTTGTATATCTACTAGGTCTTATAGCT
CAATGAAGAAAAATATTGGAACATTAACAAGAAGAAAATTAATTTATTATGAATACGTTTAAAATTAAATTTCTAAATTTTAGAACTTAATTATATGTTTTGCATGACCATCAGATGTTT
TTAAAAAAAAATTGTATATATACAAATAACGTACCACAAATTAATTTTAGTAGCACCATTTTTAAAAAATTTTCCAAAATACCACAAATGTTAGGCTTTTTCGTAATTTTAAAATTGTGG
TGTTTTTGGAATTCTAGAATTTTGGTGGTAACCTAGAAAATAAAACATCAAATATGTATATTTTCGTAGTTTCAAAATTGATATATTGTTTTAACTTTTATTAATTCAAAATTTGTTGAT
TAATTTTTTTTCTATATAATTATTTCACTGGCCAAATTAAAAAGTAGTTTTGGAGAACAAAATTTGTTTATGTTTCTCATTTGTACCTTCTTTTTAGTAATATAAGATCTTATTAATTTC
TATAATCATATAAAATTATTATTATTATTCTATATGACATTTTTCACATCACTTGGGATGAAGTCCATATAAAATGTTTAGCATGACAGTGAATGCCCCACAAGATGTTAATTTTGGTTG
TAACTTAACTTGTGGAATATATTATAGGAGCACATACCCTTGGAGTTGCACGATGCTCCTCCTTCAAGGCTAGACTTACCACTCCAGATTCTTCACTGGACTCCACTTTTGCAAACACTC
TCACTAGAACTTGCAATGCGGGGGACAATGCAGAGCAACCCTTTGATGCGACCCGCAACGATTTCGACAATGCCTACTTCAATGCGCTTCAGAGGAAATCAGGAGTCCTCTTTTCAGACC
AGACCTTATTCAACACTCCAAGGACCAGGAATCTTGTTAATGGTTATGCCCTTAATCAAGCTAAGTTTTTCTTTGATTTCCAACAGGCCATGCGCAAAATGAGCAATCTTGATGTTAAAC
TTGGCTCTCAAGGTGAAATACGTCAAAATTGCCGGACTATTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTAGGGCAAATTTAGTGAGCGTGATTCTGTTAATGCATGTTATTGTTGGGTTTCCTTTTCATGCGAGGGGCTTAAGTATGACTTATTACATGATGAGCTGTCCTATGGCTGAACAA
ATTGTGAAAAACAGTGTTAACAATGCTCTTCAAGCCGATCCCACTTTAGCCGCAGGTCTTATACGTATGTTGTTCCACGACTGTTTCATTGAG
GGATGTGATGCGTCGATTCTGCTAGAT
TCAACAAAAGACAACACTGCGGAAAAGGATTCTCCTGCGAATCTGAGTCTACGTGGCTACGAGATCATAGATGATGCAAAAGAGAAAGTTGAGAATATGTGTCCAGGAGTTGTATCTTGC
GCAGATATTGTTGCCATGGCTGCTAGAGATGCTGTCTTTTGG
GCTGGTGGTCCATATTATGACATACCAAAAGGAAGATTTGATGGTAAAAGATCGAAGATAGAAGATACAAGAAACCTT
CCTTCACCTTTTCTCAATGCCTCTCAACTCATTCAAACCTTTGGCAACCGTGGCTTCTCTCCGCAAGATGTTGTTGCTCTCTCTG
GAGCACATACCCTTGGAGTTGCACGATGCTCCTCC
TTCAAGGCTAGACTTACCACTCCAGATTCTTCACTGGACTCCACTTTTGCAAACACTCTCACTAGAACTTGCAATGCGGGGGACAATGCAGAGCAACCCTTTGATGCGACCCGCAACGAT
TTCGACAATGCCTACTTCAATGCGCTTCAGAGGAAATCAGGAGTCCTCTTTTCAGACCAGACCTTATTCAACACTCCAAGGACCAGGAATCTTGTTAATGGTTATGCCCTTAATCAAGCT
AAGTTTTTCTTTGATTTCCAACAGGCCATGCGCAAAATGAGCAATCTTGATGTTAAACTTGGCTCTCAAGGTGAAATACGTCAAAATTGCCGGACTATTAACTAA

Retrieve as FASTA