Entry information : AruPrx71-2 (HRP_5508)
Entry ID 12920
Creation 2014-06-12 (Christophe Dunand)
Last sequence changes 2014-06-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-06-12 (Christophe Dunand)
Peroxidase information: AruPrx71-2 (HRP_5508)
Name (synonym) AruPrx71-2 (HRP_5508)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Armoracia
Organism Armoracia rusticana (horseradish)    [TaxId: 3704 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AruPrx71-2
start..stop
S start..stop
AruPrx71-1 595 0 1..321 1..325
CagraPrx67 549 0 1..321 1..328
CrubPrx67 548 0 1..321 1..328
AhalPrx30 546 0 1..321 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7..417 411 N° 2 533..695 163 N° 3 974..1365 392  
join(7..417,533..695,974..1365)


exon

Literature and cross-references AruPrx71-2 (HRP_5508)
Literature REFERENCE 2 Naatsaari,L., Krainer,F.W., Schubert,M., Glieder,A. and Thallinger,G.G. Peroxidase gene discovery from the horseradish transcriptome . BMC Genomics 15 (1), 227 (2014)
Protein ref. UniProtKB:   K7ZWW9
DNA ref. GenBank:   HE963815.1
Protein sequence: AruPrx71-2 (HRP_5508)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (298)
PWM (Da):   %s   34211.42 (31762.2) Transmb domain:   %s   i7-26o
PI (pH):   %s   8.27 (8.22) Peptide Signal:   %s   cut: 24 range:24-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGLIRSLCVFITFLSCIISSAHGQAISISITIRIGFYLTTCPTAEIIVRNAVRAGFNSDPRIAPGILRMHFHDCFVQGCDGSVLISGSNTERTAVPNLSLRGFEVIENAKTQLEATCPGVVSCADILALAARDTVVLTRGIGWQVPTGRRDGRVSVASNANNLPGPRDSVAVQQQKFSALGLNTRDLVVLAGGHTLGTAGCGVFRDRLFNNTDPNVDQPFLTQLQTKCPRNGDGSVRVDLDTGSGTTFDNSYFINLSRGRGVLESDHVLWTDPATRPIVQQLMSSSGNFNAEFARSMVKMSNIGVVTGTNGEIRKVCSAIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 2 and3).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTGATTAGATCATTATGCGTATTCATAACTTTCCTCAGTTGTATCATCAGCTCGGCCCATGGCCAAGCCATCTCGATTTCTATCACAATTAGGATCGGGTTTTACTTGACCACG
TGTCCCACAGCTGAAATCATTGTTCGAAACGCCGTGAGAGCTGGTTTCAATTCTGACCCGAGAATCGCACCCGGAATATTGAGAATGCATTTCCACGACTGCTTCGTTCAAGGTTGTGAC
GGTTCAGTCCTTATATCAGGAAGTAACACCGAGAGAACCGCCGTTCCAAACCTCAGCCTCCGTGGATTTGAAGTCATAGAAAACGCCAAAACGCAGCTCGAAGCCACGTGCCCAGGAGTT
GTCTCTTGTGCTGATATTTTAGCCTTAGCTGCTCGTGATACTGTAGTCCTT
GTAAGCCCTAATCCATAAGCGCAATTGCATTAATACTACTTTTCTTGTTATATATATATATATATATAT
ATATATGTGAGAAACGTTTTACGTGCGTGGATTGATTTGCGTGCAGACGAGAGGGATAGGCTGGCAAGTACCAACGGGACGTAGAGATGGTCGAGTTTCTGTGGCCTCGAACGCTAATAA
TCTTCCAGGTCCCCGTGACTCCGTCGCCGTTCAACAACAGAAATTCTCCGCTCTCGGACTCAATACCCGCGATCTCGTCGTCCTCGCCG
GTACGTAGTAGTTTACACTTTACATACAATA
CTATAGATTACCACTAATTCGAAAAATTAACGTTGAGAAACTCTTCATGTTAATTTAAAAAAAAAAAAAAAAAAACTCTTCATGTGCATGTTCGTTAAACGATTATTTTTTTAAAAAATT
TAATTTTAACTGATTTCACCATTTTTTTTGTCCGCTTTAAAACTTCTTTGAAAATATAGAAAACTTTGTTAATATTAGGATGTGAATAATTACAACATATACTGAATTATTCATAAATTT
TTAACAGGAGGACACACGCTCGGAACAGCTGGATGCGGTGTATTCAGGGACAGACTATTCAATAACACGGATCCTAACGTCGACCAGCCATTTTTGACGCAGCTTCAAACAAAATGTCCC
CGAAACGGAGACGGTTCAGTGCGCGTGGATCTCGATACCGGAAGCGGAACCACTTTTGATAATTCCTACTTCATCAACCTAAGTCGTGGCCGCGGAGTCCTCGAATCCGATCATGTACTT
TGGACCGATCCAGCCACTAGACCCATCGTGCAACAGTTGATGAGTTCTAGTGGCAACTTCAACGCTGAATTTGCGAGGTCAATGGTCAAGATGAGTAATATCGGTGTGGTTACGGGGACT
AATGGGGAAATTCGTAAGGTTTGCTCTGCGATTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTGATTAGATCATTATGCGTATTCATAACTTTCCTCAGTTGTATCATCAGCTCGGCCCATGGCCAAGCCATCTCGATTTCTATCACAATTAGGATCGGGTTTTACTTGACCACG
TGTCCCACAGCTGAAATCATTGTTCGAAACGCCGTGAGAGCTGGTTTCAATTCTGACCCGAGAATCGCACCCGGAATATTGAGAATGCATTTCCACGACTGCTTCGTTCAAGGTTGTGAC
GGTTCAGTCCTTATATCAGGAAGTAACACCGAGAGAACCGCCGTTCCAAACCTCAGCCTCCGTGGATTTGAAGTCATAGAAAACGCCAAAACGCAGCTCGAAGCCACGTGCCCAGGAGTT
GTCTCTTGTGCTGATATTTTAGCCTTAGCTGCTCGTGATACTGTAGTCCTT
ACGAGAGGGATAGGCTGGCAAGTACCAACGGGACGTAGAGATGGTCGAGTTTCTGTGGCCTCGAACGCT
AATAATCTTCCAGGTCCCCGTGACTCCGTCGCCGTTCAACAACAGAAATTCTCCGCTCTCGGACTCAATACCCGCGATCTCGTCGTCCTCGCCG
GAGGACACACGCTCGGAACAGCTGGA
TGCGGTGTATTCAGGGACAGACTATTCAATAACACGGATCCTAACGTCGACCAGCCATTTTTGACGCAGCTTCAAACAAAATGTCCCCGAAACGGAGACGGTTCAGTGCGCGTGGATCTC
GATACCGGAAGCGGAACCACTTTTGATAATTCCTACTTCATCAACCTAAGTCGTGGCCGCGGAGTCCTCGAATCCGATCATGTACTTTGGACCGATCCAGCCACTAGACCCATCGTGCAA
CAGTTGATGAGTTCTAGTGGCAACTTCAACGCTGAATTTGCGAGGTCAATGGTCAAGATGAGTAATATCGGTGTGGTTACGGGGACTAATGGGGAAATTCGTAAGGTTTGCTCTGCGATT
AATTAA

Retrieve as FASTA