Entry information : HaAPx06 (HanXRQChr15g0483901)
Entry ID 12923
Creation 2014-06-16 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaAPx06 (HanXRQChr15g0483901)
Name (synonym) HaAPx06 (HanXRQChr15g0483901)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaAPx06
start..stop
S start..stop
LsaAPx02 458 4e-165 4..288 2..282
BnAPx03-1Aa_other 456 4e-164 4..288 2..284
HaAPx03 455 8e-164 4..284 2..280
CiAPx02 454 2e-163 4..284 2..280
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 81100170..81100288 119 N° 2 81102356..81102480 125 N° 3 81102679..81102728 50 N° 4 81102817..81102882 66
N° 5 81102955..81103003 49 N° 6 81103082..81103164 83 N° 7 81103260..81103342 83 N° 8 81103423..81103525 103
N° 9 81103912..81104100 189  
join(81100170..81100288,81102356..81102480,81102679..81102728,81102817..81102882 ,81102955..81103003,81103082..81103164,81103260..81103342,81103423..81103525,811 03912..81104100)


exon

Literature and cross-references HaAPx06 (HanXRQChr15g0483901)
DNA ref. HanXRQ genome:   HanXRQChr15 (81100170..81104100)
EST ref. Heliagene:   HaT13l018734 [Incorrect prediction]
Cluster/Prediction ref. HanXRQ:   HanXRQChr15g0483901
Protein sequence: HaAPx06 (HanXRQChr15g0483901)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   288
PWM (Da):   %s   31717.2 Transmb domain:   %s   o260-282i
PI (pH):   %s   6.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEAAAPVVDCEYLKEIERTRRDLRALISNKKCAPIMLRLAWHDAGTYDAKTKTGGPNGSIRNEEEYSHGANNGLKIAIDLEEVKSKHPRVTYADLYLAGVVAVEVTGGPTIKFVPGRKDSNVSPNEGRLPDAKQGPSHLRDVFYRMGLSDKDIVALSGGHTGKAHPERSGFDEKPWTNDPLKFDNSYFLELLKGDTDGLLQLPTDKALVEDPKFRYYVELYADEEAFFNDYAESHKKLSELGFTPPSFLKSNTPAALLAHSAIGVAVAATVVILSYFYEATIRK*

Retrieve as FASTA  
Remarks Complete sequence from genomic and ESTs. Contig from Heliagene contains 2 genes.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCAGCAGCACCTGTTGTAGACTGTGAGTATTTGAAGGAGATAGAAAGGACTCGTCGTGATCTTCGTGCTCTCATCTCCAACAAAAAATGTGCTCCTATCATGCTTCGCTTGGCG
TACGTGCTTCATATAGTTTCGTAAATCAAACAATTTCATTATTAAATAATATAGCTAAAACAAGACTGTTTTGATATGTAACTGATCCTCAATGTATTGACTGTATTAAGAAATACAGCG
CACAGCTCTCCACTATATATAGGAGACTAGAACTAAACAATAACAGAATGTACAAGCTAATAATGCATGGATAACAGAAAAGTACAAGATAGAAAAACTAGGAGCTAACTAAATAACTGA
ATGTATATGAGACTCTAATAATAACTATGTCTGATTTTTTTTTTGTCATAATCTGTTGATTGATCGACATTAGTTGAATTGTTACTCTATTATTGCTTCTATGAAATGATCATATATTGA
TTAACATTGCTTTCAAATTCTGTTTTTTGAAATTATCGAAATTAGTTAGCTCTTTTATTGCTTAATCTCTGAATTGATAATATAATGTTGATTATATATGTTTTTGCATATCCTACTAAC
TTTGTACATCAAACTAACTTCGAATTCTGTTATTTGAAATTATCGAAACTAGTTTGCTCTTTTAATGCTTAATCTCTGAATTGCTGATGAATTATTGATTATATATGTTTTGCATATAAT
CATATCGACTTTGTACATCAAACTTCAGGAACTGATAGAATTAGGTATGGTGTATTCAATTTCAGCAAATCTGATTGTAATAATTTTCTCCTATAAGTTTTTGAACGTGCTTACAATGTT
AATATGGTCTGGTTAGATAATCTGGCACTGAGTTTAGCTGTTAATGATTTAAATATGTGTGCTCTAATTCTTTGATATGAACCAATCGGATTTGGGATAAATAATCCGTTGAGTGGATTA
ACCTCAAAAGAAAATAGTAGGAAACAAGACTTGAGATAACTCTCTAATATTTTTCATTCATACCCATAACATCAAATGGCTTACACTATAAATACTTAAAAGATAAATAACTACCCACTA
ACCCATTATCTACTACTAAACTAACAAATAAAAGAAATACATGTAGATATAGTTAAACTAAAATAATGTAAATGCATGATGGACTTCGTGGGTTTCATGGCACACATCATTCCACCCCAC
TCGAATTCGACTTGTCCACAAGGCGAAAATCCGGTTACAACTTGGTGGAAACCACGGCGGACGCCACTCGGTCCGTCCCAAAGCGTTTGGAGAAGTCATAGTGAAACACCACTGTGTGGT
CTCAACGTAGCGCCACGGTGGTTGCCAATCACGTCTCCTCATGCCACCGGGGACCTTCGACATAGTTGCAAGTTCCTTTTTTGTGTGAACATTATTTGCCGAAGTTCTTTCTTCCAAAGC
TTTGTTAGGCAGAATAGATCTTGAGGAGTTCTGTGTAGTCATTGCCGGAATCGTAGTCTTCATTATAATCTTGGTTGTAACGGCAATTGTTGTTGATGGTGTGGTGAGGATTTGTGGTGG
TGTTGCTAATGGTGTGGCAGGTTTTGGTGGCGGTGTGGTAACAGTTGATGGAAGGTGGGTTGATGACTGCGGTTGGTGGTGGTGAGGCGGCAATGGCCGGTGGTGTTGTGGAGAGGTAAT
TGGTGATAGTGAGGTAGGGGTGTGGCTGGCTTCGAACACGGTTCGAATCGATCGGAACTCGTTGAGAAGGGTTTGCAACTGAGACTCGAGCTTTGCAAGGGATTCGTTCATCCATTGGTA
GAACTCGGTTTCGGATAGAGTGTGAGCAACCATGGTCGGGGGATCACGACGGCTCTGATACCAATTGATATGAACCAATCGGATTTGGGATAAATAATCCGTTGAGTGGATTAACCTCAA
AAGAAAATAGTAGGAAACAAGACTTGAGATAACTCTCTAATATTTTTCATTCATACCCATAACATCAAATGGCTTACACTATAAATACTTAAAAGATAAATAACTACCCACTAACCCATT
ATCTACTACTAAACTAACAAATAAAAGAAATACACGTAGATATAGTTAAACTAAAATAATGTAAATGCATGATGGACTTCGTGGGTTTCATGGCACACATCATTCTTTTGATGTTCATAT
CCATAAACTGAAATTTGTTGCCTCAGATGGCATGATGCTGGCACTTATGATGCTAAAACAAAGACAGGAGGCCCTAATGGATCGATCAGGAATGAGGAAGAGTACAGTCATGGAGCAAAC
AACGGCTTGAAAATTGCAATTGATCTATGTG
GTGAGTTGTCATTGCCTCATTGTTGTAAATATGAATGTTCTTTTGTCCCTCGTTGAAAAGGGAACTATTGTGACCACCATTTGAGTGGC
AATCTGCCATTAGTCCTACCAGTTCAACTACTCTCCTTGCCTGTTTAACACACCAACTCAATATATTCTTAAAGTGTTCCTTATTAAGTTTGTGTTCATCTTGATGCAGAAGAAGTGAAG
TCCAAACATCCCAGAGTCACATATGCTGATCTCTATCAG
GTGATTGTTTGAATACCAACTACAACTGGTTTGTAATCATGACTGCGTATCTGTATAATGGTTAAACTTCCACTGAAATTA
TGTTCAGCTTGCTGGAGTTGTTGCTGTTGAGGTGACGGGAGGCCCAACTATTAAGTTTGTACCCGGAAGGAAGGTATATAAAGTAGCATCTCAGTAAGAAAATTCTTACGAGTTTGTACT
TATTTTTCCAAATTTTCTTCACCAGGATTCAAACGTGTCGCCTAATGAAGGACGTCTTCCTGATGCCAAGCAAGGTCACTTGGTCCCATGATTTATTTCAATTGATTTCAGTCGTACGGA
TGAACAGATTTCTGAATTTTACTTTTGTGCAGGCCCATCCCATCTCCGTGATGTCTTCTATCGGATGGGCTTATCTGATAAGGATATAGTCGCACTTTCTGGTGGCCATACTTTGGTGAG
TTTAAATGTTTAATCACGTAAAGTTAAGAGTTAAGACAGTTGTTTTAATAAATATAATAACATAACTTGTTGTTTGATCTTTGACTGCAGGGGAAGGCACATCCTGAGAGATCAGGATTT
GATGAAAAACCTTGGACCAATGATCCTTTGAAGTTTGACAATTCATACTTTTT
GTAAGATGTTTGTTCTTTGGTTAGCACATATTGTCCTTTAAAGTTGAATGTTGTGTTCTTATGAATG
ATGGATGAATCAGGGAGCTTTTGAAGGGAGATACTGATGGACTACTGCAGCTTCCTACTGACAAAGCGTTAGTAGAGGACCCAAAGTTTCGTTACTATGTTGAACTTTATGCAAAGGTAT
GAAGAAGCATTCATTCTTATAAGTCGACATGAATGACCATTTTGACTAAACATTTGACCATATAGCCACTTGACAAAATTTTATAAAAATATAACCATTTAACTGTTACAAGTATAACAC
AATCAAAAGACGCCACATGACACGGATGTCACCATTGGCGCAGATTTGAGGTTAAAATTCGCCATTGGTTCTGCCACGTGTCATCTCACCATGGCCTGAATTTAGTGTGTGACCACACCA
TTTCATACAAGTGGGGTCGGTTTGGGGGTATACGTTTATGAAGAGATATTTTTAAAAGCAGGAAAAATGGCTATTTATGTTGTAAAAATGGATGTGATTTTCATATATTCAATAACTAAT
TGTTGTAAACAATTGAGCGCAGGATGAAGAGGCATTCTTCAATGACTATGCTGAATCACACAAGAAGCTTTCAGAGCTGGGTTTCACCCCACCATCTTTTCTAAAATCAAATACTCCAGC
AGCCTTGTTGGCACACAGTGCTATAGGAGTTGCTGTTGCTGCTACTGTGGTCATCCTCAGCTACTTCTATGAAGCCACCATAAGGAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCAGCAGCACCTGTTGTAGACTGTGAGTATTTGAAGGAGATAGAAAGGACTCGTCGTGATCTTCGTGCTCTCATCTCCAACAAAAAATGTGCTCCTATCATGCTTCGCTTGGCA
TGGCATGATGCTGGCACTTATGATGCTAAAACAAAGACAGGAGGCCCTAATGGATCGATCAGGAATGAGGAAGAGTACAGTCATGGAGCAAACAACGGCTTGAAAATTGCAATTGATCTA
TGTG
AAGAAGTGAAGTCCAAACATCCCAGAGTCACATATGCTGATCTCTATCAGCTTGCTGGAGTTGTTGCTGTTGAGGTGACGGGAGGCCCAACTATTAAGTTTGTACCCGGAAGGAAG
GATTCAAACGTGTCGCCTAATGAAGGACGTCTTCCTGATGCCAAGCAAGGCCCATCCCATCTCCGTGATGTCTTCTATCGGATGGGCTTATCTGATAAGGATATAGTCGCACTTTCTGGT
GGCCATACTTTG
GGGAAGGCACATCCTGAGAGATCAGGATTTGATGAAAAACCTTGGACCAATGATCCTTTGAAGTTTGACAATTCATACTTTTTGGAGCTTTTGAAGGGAGATACTGAT
GGACTACTGCAGCTTCCTACTGACAAAGCGTTAGTAGAGGACCCAAAGTTTCGTTACTATGTTGAACTTTATGCAAAG
GATGAAGAGGCATTCTTCAATGACTATGCTGAATCACACAAG
AAGCTTTCAGAGCTGGGTTTCACCCCACCATCTTTTCTAAAATCAAATACTCCAGCAGCCTTGTTGGCACACAGTGCTATAGGAGTTGCTGTTGCTGCTACTGTGGTCATCCTCAGCTAC
TTCTATGAAGCCACCATAAGGAAATAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CATAAATACT CTCTCGATAT CAGATCCGGT GAGTGCTCAA CGAACTCGAA AGCATTAAAT CTGTTGAGTT TTTCAGATTG TATTCACTTT TTGAAGTAGA TTTTGTGCAA TTAGCAGAGG  TTGAAATCAG TCTATTGAAA CATAAATGGA GGCAGCAGCA CCTGTTGTAG ACTGTGAGTA TTTGAAGGAG ATAGAAAGGA CTCGTCGTGA TCTTCGTGCT CTCATCTCCA ACAAAAAATG  TGCTCCTATC ATGCTTCGCT TGGCATGGCA TGATGCTGGC ACTTATGATG CTAAAACAAA GACAGGAGGC CCTAATGGAT CGATCAGGAA TGAGGAAGAG TACAGTCATG GAGCAAACAA  CGGCTTGAAA ATTGCAATTG ATCTATGTGA AGAAGTGAAG TCCAAACATC CCAGAGTCAC ATATGCTGAT CTCTATCAGC TTGCTGGAGT TGTTGCTGTT GAGGTGACGG GAGGCCCAAC  TATTAAGTTT GTACCCGGAA GGAAGGATTC AAACGTGTCG CCTAATGAAG GACGTCTTCC TGATGCCAAG CAAGGCCCAT CCCATCTCCG TGATGTCTTC TATCGGATGG GCTTATCTGA  TAAGGATATA GTCGCACTTT CTGGTGGCCA TACTTTGGGG AAGGCACATC CTGAGAGATC AGGATTTGAT GAAAAACCTT GGACCAATGA TCCTTTGAAG TTTGACAATT CATACTTTTT  GGAGCTTTTG AAGGGAGATA CTGATGGACT ACTGCAGCTT CCTACTGACA AAGCGTTAGT AGAGGACCCA AAGTTTCGTT ACTATGTTGA ACTTTATGCA AAGGATGAAG AGGCATTCTT  CAATGACTAT GCTGAATCAC ACAAGAAGCT TTCAGAGCTG GGTTTCACCC CACCATCTTT TCTAAAATCA AATACTCCAG CAGCCTTGTT GGCACACAGT GCTATAGGAG TTGCTGTTGC  TGCTACTGTG GTCATCCTCA GCTACTTCTA TGAAGCCACC ATAAGGAAAT AAGTCTATGA TTCGTTTTAG TCGATTATCG AACATACACA AACGCGAACA CGAACACAAA CACAAACACT  CATGGTTGAT TTGCATTCAT AAATAAATTG ACACATTGCC ATTGCTTATT GCCATACAAT CCATATCCCC CGGAGAACAA GTGTATCTCC AACCTAAAGT TTAAATGAAC TAAGTAAGAG  TTAGTCAGTT ATAGGGGTGA GCAAGGTCCA TGTTCGGCTC GAGAAAATGA CACGGAGCAA CCCGACTGAC TCAGTTATAT AATGTTATTG TTAAGTGTTG AGTTTCCTCA AGCTCTTGAA  GGACTTATTA TTGATGGGGT GATGTCTTGA AAAACCTTGA GCCTCTTTTC TATCTTTCTC TCCACCAGCT TCATATTCTC CGGTTTTGTG CTCGAACCCA AAACCGCAGC AATAATAGCT 
TTTTCAAAGT CCTTACTGTC GGGCAAAAAT CCTGTCCGAC CATCGGGTGA 

Retrieve as FASTA