Entry information : TaPrx113-1A (Prx113-A)
Entry ID 12926
Creation 2014-06-18 (Christophe Dunand)
Last sequence changes 2014-06-18 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-06-18 (Christophe Dunand)
Peroxidase information: TaPrx113-1A (Prx113-A)
Name (synonym) TaPrx113-1A (Prx113-A)
Class Class III peroxidase    [Orthogroup: Prx086]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Triticum
Organism Triticum aestivum (bread wheat)    [TaxId: 4565 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TaPrx113-1A
start..stop
S start..stop
AvePrx113-1A 635 0 1..312 1..312
TmPrx01 628 0 1..312 1..312
TaPrx113-1D 608 0 1..312 1..312
HvPrx08 598 0 1..312 1..312
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 47..253 207 N° 2 354..530 177 N° 3 612..1166 555  
join(47..253,354..530,612..1166)


exon

Literature and cross-references TaPrx113-1A (Prx113-A)
Literature Simonetti,E., Veronico,P., Melillo,M.T., Delibes,A., Andres,M.F. and Lopez-Brana,I. Analysis of class III peroxidase genes expressed in roots of resistant and susceptible wheat lines infected by Heterodera avenae. Mol. Plant Microbe Interact. 22 (9), 1081-1092 (2009)
DNA ref. GenBank:   EU595576.1
Protein sequence: TaPrx113-1A (Prx113-A)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   312 (290)
PWM (Da):   %s   32559.98 (30530.9) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.64 (5.64) Peptide Signal:   %s   cut: 23 range:23-312
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASASCISLVVLVALATVASAQLSPTFYDTSCPRALATIKSGVMAAVSTDPRMGASLLRLHFHDCFVQGCDASVLLSGMEQNALPNNGSLRGFGVIDSIKTQIEAICAQTVSCADILTVAARDSVVALGGPSWTVPLGRRDSIDANEAAANSDLPGPTSSRSDLELAFSNKGLNTVDMVALSGAHTIGQAQCGTFKDRIYNETNIDTTFATSLRANCPRSNGDGSLANLDTTTANTFDNAYYTNLMSQKGLLHSDQVLFNNDTTDNTVRNFASNPAAFSSAFTTAMIKMGNIAPKTGTQGQIRLSCSRVNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCTCTGCTTCTTGCATTTCACTGGTGGTGCTCGTGGCTCTGGCCACGGTGGCGTCGGCGCAGCTGTCGCCGACGTTCTACGACACGTCGTGCCCCAGGGCCCTGGCCACCATC
AAGAGCGGCGTCATGGCCGCCGTGAGCACCGACCCTCGGATGGGCGCGTCGCTGCTCCGGCTGCACTTCCACGACTGCTTCGTCCAA
GTAAGTTGGCCACATGCATGCATGCATATCCCG
ATAGCCGTCACGTACCCTGTTTTGTATAGGTTTTGCTTGCTAAACACTATAAGCATGTGATGTGCAGGGCTGTGACGCGTCTGTTCTGCTTTCTGGCATGGAACAAAACGCTCTCCCGAA
CAACGGGTCACTGCGGGGCTTCGGCGTCATCGACAGCATCAAGACACAGATCGAGGCCATCTGCGCCCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCTGCCCGTGACTCCGTTGT
CGCC
GTAAGAATATCATCTTACGATCGTGTACATCATCGATTGGATGCCATCGTTAACCGTTTTCTTCGTATCCTTCGCGTGCAGCTCGGAGGGCCATCATGGACAGTCCCTCTGGGAAG
AAGGGATTCCATAGATGCAAACGAGGCGGCGGCAAACAGCGACCTCCCAGGCCCTACGTCTAGCCGGTCAGATCTTGAGCTGGCATTCAGCAACAAGGGCCTCAATACGGTCGACATGGT
GGCCCTCTCCGGCGCGCACACCATCGGCCAGGCGCAGTGCGGGACCTTCAAGGACAGGATCTACAACGAGACTAACATCGACACGACCTTCGCCACATCTCTCCGGGCCAACTGCCCCCG
GTCCAACGGTGACGGCAGCCTGGCGAACCTGGACACGACGACGGCCAACACGTTCGACAACGCCTACTACACCAACCTCATGTCACAGAAGGGGCTCCTGCACTCGGACCAGGTGCTGTT
CAACAACGACACCACCGACAACACCGTCCGGAACTTCGCGTCCAACCCGGCGGCGTTCAGCAGCGCGTTCACGACGGCCATGATCAAGATGGGCAACATCGCGCCGAAGACGGGGACGCA
AGGGCAGATCAGGCTTAGCTGCTCCAGGGTGAACTCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCTCTGCTTCTTGCATTTCACTGGTGGTGCTCGTGGCTCTGGCCACGGTGGCGTCGGCGCAGCTGTCGCCGACGTTCTACGACACGTCGTGCCCCAGGGCCCTGGCCACCATC
AAGAGCGGCGTCATGGCCGCCGTGAGCACCGACCCTCGGATGGGCGCGTCGCTGCTCCGGCTGCACTTCCACGACTGCTTCGTCCAA
GGCTGTGACGCGTCTGTTCTGCTTTCTGGCATG
GAACAAAACGCTCTCCCGAACAACGGGTCACTGCGGGGCTTCGGCGTCATCGACAGCATCAAGACACAGATCGAGGCCATCTGCGCCCAGACCGTCTCCTGCGCCGACATCCTCACCGTC
GCTGCCCGTGACTCCGTTGTCGCC
CTCGGAGGGCCATCATGGACAGTCCCTCTGGGAAGAAGGGATTCCATAGATGCAAACGAGGCGGCGGCAAACAGCGACCTCCCAGGCCCTACGTCT
AGCCGGTCAGATCTTGAGCTGGCATTCAGCAACAAGGGCCTCAATACGGTCGACATGGTGGCCCTCTCCGGCGCGCACACCATCGGCCAGGCGCAGTGCGGGACCTTCAAGGACAGGATC
TACAACGAGACTAACATCGACACGACCTTCGCCACATCTCTCCGGGCCAACTGCCCCCGGTCCAACGGTGACGGCAGCCTGGCGAACCTGGACACGACGACGGCCAACACGTTCGACAAC
GCCTACTACACCAACCTCATGTCACAGAAGGGGCTCCTGCACTCGGACCAGGTGCTGTTCAACAACGACACCACCGACAACACCGTCCGGAACTTCGCGTCCAACCCGGCGGCGTTCAGC
AGCGCGTTCACGACGGCCATGATCAAGATGGGCAACATCGCGCCGAAGACGGGGACGCAAGGGCAGATCAGGCTTAGCTGCTCCAGGGTGAACTCGTGA

Retrieve as FASTA