Entry information : HaPrx28 (HanXRQChr13g0399671/HaT13l025662_1)
Entry ID 12974
Creation 2014-10-16 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx28 (HanXRQChr13g0399671/HaT13l025662_1)
Name (synonym) HaPrx28 (HanXRQChr13g0399671/HaT13l025662_1)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx28
start..stop
S start..stop
HaPrx29 583 0 1..323 1..325
HarPrx02 580 0 1..323 1..325
LsaPrx46 568 0 1..323 1..321
LperPrx46 532 0 1..300 1..298
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 84978934..84978994 61 N° 2 84978602..84978750 149 N° 3 84978284..84978472 189 N° 4 84977893..84978058 166
N° 5 84977421..84977827 407  
complement(join(84977421..84977827,84977893..84978058,84978284..84978472,8497860 2..84978750,84978934..84978994))


exon

Literature and cross-references HaPrx28 (HanXRQChr13g0399671/HaT13l025662_1)
DNA ref. HanXRQ genome:   HanXRQChr13 (84978994..84977421)
Cluster/Prediction ref. HanXRQ:   HanXRQChr13g0399671
Protein sequence: HaPrx28 (HanXRQChr13g0399671/HaT13l025662_1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (300)
PWM (Da):   %s   36274.03 (33596.6)  
PI (pH):   %s   6.31 (5.76) Peptide Signal:   %s   cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIHKLLCNLSFIFLLFFHFGKGEIRLNYYSESCPNAEEIVKQEVISLYHKHGNTAVSWLRTLFHDCMVSCDASILLESINGIQSEKTSTRNMGMRNFKYINTIKDALEKSCPMTVSCADIVALSARDGVVLLGGPHIEMKTGRKDSKESHLAEIDELLPNHNDSMAYVLSRFQSVGIDVEGTVALLGAHSVGRVHCANIVGRLYPTVDPTLDPNHAEYLKRRCPHPNPDPNAVEYSRNDLKTPMILDNMYYKNIMNNKGLLIVDQQLVSDPITSPFVENMATDNDYFHQQFSKALLTLSENNPLTEEDGEVRRDCRFVNSN

Retrieve as FASTA  
Remarks Complete sequence from genomic and ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATTCACAAGCTGCTTTGCAATCTAAGCTTCATTTTCCTCTTATTCTTCCATTTTGGTATTTCTAGTTTTCTACACACATTTTTTTATTTTTTTTTGTACTTTTATAAATATACA
ACATGTAAAGGCTACATGTTGACTCATTAGGGTCATACCGATCTTTTTTTTTTTCAAATCAATGTCAACATCTATACGTTACATAGTGTAATTTATATAAATGTGTTATATACTATCTTT
GTAGGTAAAGGTGAAATCCGATTAAATTACTATTCAGAAAGTTGTCCAAACGCCGAAGAAATTGTAAAACAAGAAGTTATAAGTTTGTACCATAAACATGGAAACACTGCGGTTTCTTGG
CTTAGAACTCTCTTCCATGATTGCATGGTTAAG
GTAATAATTTACGCGCGCTTTTAACTTTCTTGGTTTTCAATAATGAACTTGTAAAAAGGTTATGTTTATCATAAAGAGATTCGTTAT
TCCTGACCCTGATCACATTTGAAATGTTTATGTTTTTTATAGTCATGTGACGCATCAATATTATTGGAGAGCATAAATGGGATACAATCAGAAAAGACATCAACAAGAAACATGGGGATG
AGAAACTTCAAGTACATAAACACAATCAAAGATGCACTTGAGAAGTCATGCCCCATGACTGTCTCTTGCGCGGACATTGTTGCTCTTTCGGCTAGAGATGGTGTCGTTTTG
GTATGTAAT
TACGCTTTTTTTTTAAACAGGAAATCGTAATGAGGTTGTTATTAAAGGATTGTAAATTTCTTGTCTCATAAAAATAATGTACATGAATTTATATATTTATATAAATTTATATAGAGATAT
AATCTACCTTGATACTAAAACCCTAATGGGCTTAACACTTACTTACAAGTTACAATATTTCTAATAGTTACTTGTTTATTCCTTTGTGTTACATAGTTAGGAGGACCACACATTGAGATG
AAAACCGGGCGAAAAGATAGCAAAGAAAGCCATCTTGCAGAAATCGATGAATTGCTACCGAATCATAATGATTCGATGGCGTATGTTCTTTCGCGCTTTCAATCCGTGGGAATTGATGTT
GAAGGAACAGTTGCTCTCTTAG
GTAACAGCAATATTCACTTAAACTATGTCATAAAACATTTAATAATCCAATTAGTTTTGATGTAGGTGCTCACTCAGTAGGTAGGGTCCATTGTGCCA
ACATAGTGGGCCGGCTCTATCCGACAGTTGACCCGACCTTGGACCCAAACCACGCTGAATACCTCAAGCGTCGTTGTCCCCATCCTAACCCAGACCCTAATGCTGTGGAATATTCAAGAA
ATGACCTAAAAACACCAATGATCTTAGACAACATGTATTACAAGAACATTATGAACAACAAAGGACTACTTATAGTTGATCAACAACTTGTTTCGGACCCGATTACATCTCCATTTGTTG
AGAACATGGCAACGGATAACGATTACTTTCATCAACAGTTTTCTAAGGCTCTTCTCACTTTGTCAGAGAATAACCCGCTAACCGAGGAAGACGGCGAGGTTCGAAGAGATTGTCGTTTTG
TAAATAGTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATTCACAAGCTGCTTTGCAATCTAAGCTTCATTTTCCTCTTATTCTTCCATTTTGGTAAAGGTGAAATCCGATTAAATTACTATTCAGAAAGTTGTCCAAACGCCGAAGAAATT
GTAAAACAAGAAGTTATAAGTTTGTACCATAAACATGGAAACACTGCGGTTTCTTGGCTTAGAACTCTCTTCCATGATTGCATGGTTAAG
TCATGTGACGCATCAATATTATTGGAGAGC
ATAAATGGGATACAATCAGAAAAGACATCAACAAGAAACATGGGGATGAGAAACTTCAAGTACATAAACACAATCAAAGATGCACTTGAGAAGTCATGCCCCATGACTGTCTCTTGCGCG
GACATTGTTGCTCTTTCGGCTAGAGATGGTGTCGTTTTG
TTAGGAGGACCACACATTGAGATGAAAACCGGGCGAAAAGATAGCAAAGAAAGCCATCTTGCAGAAATCGATGAATTGCTA
CCGAATCATAATGATTCGATGGCGTATGTTCTTTCGCGCTTTCAATCCGTGGGAATTGATGTTGAAGGAACAGTTGCTCTCTTAG
GTGCTCACTCAGTAGGTAGGGTCCATTGTGCCAAC
ATAGTGGGCCGGCTCTATCCGACAGTTGACCCGACCTTGGACCCAAACCACGCTGAATACCTCAAGCGTCGTTGTCCCCATCCTAACCCAGACCCTAATGCTGTGGAATATTCAAGAAAT
GACCTAAAAACACCAATGATCTTAGACAACATGTATTACAAGAACATTATGAACAACAAAGGACTACTTATAGTTGATCAACAACTTGTTTCGGACCCGATTACATCTCCATTTGTTGAG
AACATGGCAACGGATAACGATTACTTTCATCAACAGTTTTCTAAGGCTCTTCTCACTTTGTCAGAGAATAACCCGCTAACCGAGGAAGACGGCGAGGTTCGAAGAGATTGTCGTTTTGTA
AATAGTAACTAA

Retrieve as FASTA