Entry information : HaPrx29 (HanXRQChr02g0052011/ HaT13l019937_1)
Entry ID 12975
Creation 2014-10-16 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx29 (HanXRQChr02g0052011/ HaT13l019937_1)
Name (synonym) HaPrx29 (HanXRQChr02g0052011/ HaT13l019937_1)
Class Class III peroxidase    [Orthogroup: Prx031]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx29
start..stop
S start..stop
HarPrx02 663 0 1..325 1..325
HaPrx28 583 0 1..325 1..323
LsaPrx46 560 0 1..325 1..321
LperPrx46 527 0 1..302 1..298
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 151217719..151217785 67 N° 2 151217342..151217490 149 N° 3 151216998..151217186 189 N° 4 151216332..151216497 166
N° 5 151215362..151215768 407  
complement(join(151215362..151215768,151216332..151216497,151216998..151217186,1 51217342..151217490,151217719..151217785))


exon

Literature and cross-references HaPrx29 (HanXRQChr02g0052011/ HaT13l019937_1)
DNA ref. HanXRQ genome:   HanXRQChr02 (151217785..151215362)
Cluster/Prediction ref. HanXRQ:   HanXRQChr02g0052011
Protein sequence: HaPrx29 (HanXRQChr02g0052011/ HaT13l019937_1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (300)
PWM (Da):   %s   36360.91 (33417.4) Transmb domain:   %s   i7-24o
PI (pH):   %s   5.08 (4.79) Peptide Signal:   %s   cut: 26 range:26-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATHKLLCNLSFIFLLFFQFHFGTSEIRLNYYSETCPNAEEIIKEQVISLYNKHGNTAVSWIRTLFHDCMVSCDASLLLESINGIQSEKISSRNMGMRNFKYINTIKDAVESACPLTVSCADIVALSARDGAVMLGGPCIEMKTGRKDSKESHLAEIDASLPNHNDSMMYVLARFQSIGIDVEGTVALLGAHSVGRVHCVNIVDRLYPTVDPTLDPNYAEYLKGRCPHPDPDPIAVEYARNDRDTPMILDNSYYKNLMNHKGLLTVDQELVSNPITSPFVEKMAADNDYFHEQFSKALLILSENNPLSEEEGEVRTDCRFVNKD

Retrieve as FASTA  
Remarks Complete sequence from genomic and ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACCCACAAGTTACTTTGCAATCTAAGCTTCATCTTCCTCTTGTTCTTCCAATTTCATTTTGGTATTTCTATACACATTTTCACTTTTAATTTACTTTGTAACATGTAATTATAC
CAGGTGTGAGGCGATCTACATGCTGATTTATTAGTCGTTTGATTGGTTTCTTTGAAACCAACGACTTTTAGCACACGTAGATCACACACCTTGGCCAGTACTTACAACGTATACAGATAT
GATATATTAAACATATATGATATATATTTATACGTGTTATATATTGTTTTTGAAGGTACGAGTGAAATACGGTTAAATTACTATTCGGAAACTTGTCCTAATGCCGAAGAAATCATCAAA
GAACAAGTCATAAGTTTGTATAATAAGCATGGAAACACTGCTGTTTCTTGGATAAGAACTCTCTTCCATGATTGCATGGTTAAG
GTACTCTTTACTTATGTTTGTTGCATGGAAAAGATT
CAAGCTTTTCATGATAAAACATTGTACAACACATAATGCACATGTTACAAGTCATCATTGCATGATCAATTCCTTCATTTCTTGGTTTTAATTCTTGATTAAAATGTTCTTTTTAATAGT
CATGTGATGCATCATTATTATTGGAGAGCATAAATGGAATTCAGTCAGAAAAAATATCATCAAGAAACATGGGAATGAGAAACTTTAAGTACATAAACACAATCAAAGATGCTGTTGAGA
GTGCATGCCCCTTGACAGTTTCTTGTGCTGACATTGTTGCTCTTTCCGCTAGAGATGGTGCCGTTATG
GTATGTGATTATGCACTCTCTTATATATATATATATATATATATATATATAT
ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATGATTTAAAATGAGAAGCCACTACGAGTTGTGAGAACCGTGAGAACTTTTTGATCCGGCAC
GAGTTGGGCCAAAATTTTTTTGCATAAACGTAGATGAAAACATTATAAACACATCTGTAAAAAGGTAAAAAAAAAGTTGTCGAGTCGTTAGTTTTGACTGATTCAAGTTTTTTTTTACGC
CCTGATAAAAGCTGTAAAATTTTACACCAATGCGTAAAAAAAAACTTCTGTCAGTCAAAACTAACGACTTGACAACTTTTTTTACAGATGTGTTTATAATGTTTTCATCTACGTTTGTGA
AAAAAAAAATTGGCCCAATTCACGCCGGATCAAAAAGTTCTCAGGATGAGAAGTTGGATGCAATCGTTTATTCGCGTGTGTTATGCAGTTGGGAGGACCGTGTATTGAGATGAAAACGGG
GAGAAAAGATAGCAAGGAAAGCCATCTTGCGGAGATCGATGCATCGCTCCCGAATCATAACGATTCCATGATGTATGTCCTTGCTCGGTTTCAATCTATAGGAATTGATGTCGAAGGAAC
AGTGGCTCTTTTAG
GTATCATTCATACTTTTTTACATCTACTTTTAGCTAACCACTCTTAACTCCATTTTGTATTAAAAGTACATTTTAAAGTATTTACTAGAATACGAATCTTGCTAAA
GATGCAACAAAACTTTTGGACTAATGTGGAGAATCACAATCATGGAGAAAACATAATTGTGGTAGGGAAAATAACAAAGAGAAAGTTATCAAAATAGGCTAAGTTTTGGCTGCCCGCGGC
TAAGATAGAGCTGACACCTTACACGTGGACCTGACACCTTACACGTGTAATTATTAGACTGACTCTTTTATGGGCTCACTAATTTTTGTGACCGTTAAATTTCAAACTCCTTACCTGACT
TTGCTTATTTAAGTCTTCTAATTGGTAGCTTAGACTCGAGTTGGAACTAATTTTTGCGACCAAAATTTCACGCTCAAAATTAGTGATTGCCTTTGGTACCAAACCTTTTACGACTAAAAC
CATTGGCGACCGGCCCTGTCAGCAATCGATTTTGCGATCAACCATATTAGCCATTAGTGACTTGTTTGTGGACTGACCTATTACTGGTTTGGTGTAGGTGCTCACTCGGTAGGTCGAGTC
CATTGTGTCAACATTGTTGATAGACTATATCCAACAGTTGACCCAACTTTGGACCCGAACTATGCTGAGTATCTCAAGGGTCGTTGTCCCCATCCTGATCCAGACCCGATTGCTGTGGAA
TACGCGAGGAACGATCGAGATACACCGATGATCCTAGACAACAGCTACTACAAAAACCTTATGAACCACAAGGGACTGCTTACAGTTGATCAAGAACTTGTATCGAACCCAATCACATCT
CCATTTGTTGAGAAAATGGCAGCCGATAACGATTACTTTCACGAACAATTTTCTAAGGCTCTTCTCATATTGTCGGAGAACAACCCGTTAAGCGAGGAGGAGGGCGAGGTTCGAACCGAT
TGTCGTTTTGTAAACAAGGACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACCCACAAGTTACTTTGCAATCTAAGCTTCATCTTCCTCTTGTTCTTCCAATTTCATTTTGGTACGAGTGAAATACGGTTAAATTACTATTCGGAAACTTGTCCTAATGCCGAA
GAAATCATCAAAGAACAAGTCATAAGTTTGTATAATAAGCATGGAAACACTGCTGTTTCTTGGATAAGAACTCTCTTCCATGATTGCATGGTTAAG
TCATGTGATGCATCATTATTATTG
GAGAGCATAAATGGAATTCAGTCAGAAAAAATATCATCAAGAAACATGGGAATGAGAAACTTTAAGTACATAAACACAATCAAAGATGCTGTTGAGAGTGCATGCCCCTTGACAGTTTCT
TGTGCTGACATTGTTGCTCTTTCCGCTAGAGATGGTGCCGTTATG
TTGGGAGGACCGTGTATTGAGATGAAAACGGGGAGAAAAGATAGCAAGGAAAGCCATCTTGCGGAGATCGATGCA
TCGCTCCCGAATCATAACGATTCCATGATGTATGTCCTTGCTCGGTTTCAATCTATAGGAATTGATGTCGAAGGAACAGTGGCTCTTTTAG
GTGCTCACTCGGTAGGTCGAGTCCATTGT
GTCAACATTGTTGATAGACTATATCCAACAGTTGACCCAACTTTGGACCCGAACTATGCTGAGTATCTCAAGGGTCGTTGTCCCCATCCTGATCCAGACCCGATTGCTGTGGAATACGCG
AGGAACGATCGAGATACACCGATGATCCTAGACAACAGCTACTACAAAAACCTTATGAACCACAAGGGACTGCTTACAGTTGATCAAGAACTTGTATCGAACCCAATCACATCTCCATTT
GTTGAGAAAATGGCAGCCGATAACGATTACTTTCACGAACAATTTTCTAAGGCTCTTCTCATATTGTCGGAGAACAACCCGTTAAGCGAGGAGGAGGGCGAGGTTCGAACCGATTGTCGT
TTTGTAAACAAGGACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCTACATAAA GCATAGATAC CATGGCAACC CACAAGTTAC TTTGCAATCT AAGCTTCATC TTCCTCTTGT TCTTCCAATT TCATTTTGGT ACGAGTGAAA TACGGTTAAA TTACTATTCG  GAAACTTGTC CTAATGCCGA AGAAATCATC AAAGAACAAG TCATAAGTTT GTATAATAAG CATGGAAACA CTGCTGTTTC TTGGATAAGA ACTCTCTTCC ATGATTGCAT GGTTAAGTCA  TGTGATGCAT CATTATTATT GGAGAGCATA AATGGAATTC AGTCAGAAAA AATATCATCA AGAAACATGG GAATGAGAAA CTTTAAGTAC ATAAACACAA TCAAAGATGC TGTTGAGAGT  GCATGCCCCT TGACAGTTTC TTGTGCTGAC ATTGTTGCTC TTTCCGCTAG AGATGGTGCC GTTATGTTGG GAGGACCGTG TATTGAGATG AAAACGGGGA GAAAAGATAG CAAGGAAAGC  CATCTTGCGG AGATCGATGC ATCGCTCCCG AATCATAACG ATTCCATGAT GTATGTCCTT GCTCGGTTTC AATCTATAGG AATTGATGTC GAAGGAACAG TGGCTCTTTT AGGTGCTCAC  TCGGTAGGTC GAGTCCATTG TGTCAACATT GTTGATAGAC TATATCCAAC AGTTGACCCA ACTTTGGACC CGAACTATGC TGAGTATCTC AAGGGTCGTT GTCCCCATCC TGATCCAGAC  CCGATTGCTG TGGAATACGC GAGGAACGAT CGAGATACAC CGATGATCCT AGACAACAGC TACTACAAAA ACCTTATGAA CCACAAGGGA CTGCTTACAG TTGATCAAGA ACTTGTATCG  AACCCAATCA CATCTCCATT TGTTGAGAAA ATGGCAGCCG ATAACGATTA CTTTCACGAA CAATTTTCTA AGGCTCTTCT CATATTGTCG GAGAACAACC CGTTAAGCGA GGAGGAGGGC  GAGGTTCGAA CCGATTGTCG TTTTGTAAAC AAGGACTAAA ATCACTCAAA GTGTGTGTAA TTTCTGAATT TTGTGGTATT GTTATCTTTG TATGTGACAT ATCTAAGGTT ATGTCACTAA 
AGGTGAATGA ATAAACTTTG TAATTAATAT TATGTATTAT TTTCTTGTTT AACGACCTTA TTTTAAAATG TGAA 

Retrieve as FASTA