Entry information : CfioCIIAA01_PJ7
Entry ID 13157
Creation 2015-04-20 (Christophe Dunand)
Last sequence changes 2015-04-20 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-04-20 (Christophe Dunand)
Peroxidase information: CfioCIIAA01_PJ7
Name CfioCIIAA01_PJ7
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum fioriniae (Glomerella acutata)    [TaxId: 710243 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CfioCIIAA01_PJ7
start..stop
S start..stop
CfioCIIAA01_MH18 845 0 1..409 1..409
ChigCIIAA01 758 0 1..409 1..410
CgraCIIAA01 752 0 1..411 1..411
CgloCIIAA03_ST23 727 0 1..411 1..409
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..579 579 N° 2 649..1065 417 N° 3 1131..1370 240  
join(1..579,649..1065,1131..1370)


exon

Literature and cross-references CfioCIIAA01_PJ7
Literature Baroncelli,R., Sreenivasaprasad,S., Sukno,S.A., Thon,M.R. and Holub,E. Draft Genome Sequence of Colletotrichum acutatum Sensu Lato (Colletotrichum fioriniae). Genome Announc 2 (2) (2014)
DNA ref. GenBank:   NW_006889058.1 (242381..241012)
Cluster/Prediction ref. Genebank:   19031720
Protein sequence: CfioCIIAA01_PJ7
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   411 (390)
PWM (Da):   %s   44407.34 (42327.2)  
PI (pH):   %s   7.09 (7.01) Peptide Signal:   %s   cut: 22 range:22-411
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHLTSVLATSLALVSLPGTMGYPGMGEQMAEIMARKSDAGDSTELLGDLVTLKDKDLTPVGKDIKKMLQGKGDPESNDRYSKVPDLTSDKCKKDTCCVWRYVADDMYQFMAGKSGRCTGLARAAVRLGFHDAGTWSKATASQGGGADGSILLAPGEIDRFENRGLQEIAVKFRELYGKYKGMGWDIGMGDFIQMGANVATVVCPLGPRIKSYVGRKDSANGSPGGLLPSPFQPADQLIQLFRDKTIGPHGLVALLGAHTTSQQNFVNTTRAGDPQDSTPGVWDVLYYKETLSSNSPPRVFKFPSDIAISQHPETAKEFKEFAGPGGQNHWNEDYAREYIRLSLLGVNNINQLTECTKVLPPAVNGFRAVDQYKLDKWLNSVGNKGAAKKVAEDIEKGEPASVEVPPVNNRN*

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTCACATCCGTCCTCGCCACCTCCCTGGCCCTGGTCTCCCTCCCAGGGACCATGGGCTACCCAGGCATGGGCGAGCAAATGGCCGAAATCATGGCCCGCAAGAGCGACGCCGGT
GACTCGACCGAGCTTCTCGGCGACCTCGTCACCCTCAAAGACAAGGACCTCACCCCCGTCGGCAAGGACATCAAGAAGATGCTTCAGGGCAAAGGCGACCCAGAGTCTAATGACCGCTAC
AGCAAGGTGCCCGACCTGACCTCGGACAAGTGCAAAAAGGACACCTGCTGCGTCTGGCGCTACGTCGCCGATGACATGTACCAGTTCATGGCCGGCAAGTCGGGTCGCTGTACAGGTCTG
GCCCGCGCCGCCGTCCGCCTCGGCTTTCACGACGCCGGGACCTGGTCCAAGGCTACGGCGTCCCAGGGCGGCGGCGCAGACGGCAGCATCCTGCTTGCCCCCGGCGAGATTGATCGCTTC
GAGAACCGTGGTCTGCAGGAGATTGCCGTCAAGTTCCGGGAGCTGTACGGCAAGTACAAGGGTATGGGCTGGGATATTGGCATGGGCGACTTCATCCAA
GTACGTTTGCAAGATAACTGA
ATCAATCCCATATTCGCTTCTGTCTTTACTAACCACATGTAAACATAGATGGGCGCCAACGTCGCAACAGTAGTCTGTCCCCTCGGCCCGCGCATCAAGTCCTACGTCGGCCGCAAAGAC
AGCGCCAACGGCTCCCCTGGCGGCCTCCTCCCGAGCCCCTTCCAGCCCGCCGACCAGCTCATTCAGCTCTTCCGCGACAAGACCATCGGCCCGCACGGTCTCGTCGCCTTGCTCGGCGCG
CACACTACTAGCCAGCAGAACTTTGTCAACACAACCCGCGCTGGTGACCCCCAGGACAGCACACCTGGTGTCTGGGATGTGCTCTACTACAAGGAGACTCTCAGCTCCAACTCGCCGCCT
CGCGTCTTCAAGTTCCCCAGCGACATTGCCATCTCCCAGCACCCCGAGACGGCCAAGGAGTTCAAGGAGTTTGCTGGCCCTGGCGGACAGAACCACTGGAACGAG
GTAAGATGATTTCTC
CCCTTGACTTGTGCGCTGCAAGCACGGTGCTAACATGGCTTGCCCAATAGGATTACGCTCGTGAATATATCCGTCTCTCTCTTCTGGGCGTCAACAACATCAACCAGCTCACCGAGTGCA
CCAAGGTCTTGCCCCCTGCTGTGAACGGTTTCCGCGCCGTTGATCAGTACAAGCTCGACAAGTGGCTCAACAGCGTCGGCAACAAGGGCGCTGCGAAGAAGGTTGCCGAGGATATCGAGA
AGGGCGAGCCTGCGTCTGTTGAGGTTCCCCCTGTCAACAACCGCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTCACATCCGTCCTCGCCACCTCCCTGGCCCTGGTCTCCCTCCCAGGGACCATGGGCTACCCAGGCATGGGCGAGCAAATGGCCGAAATCATGGCCCGCAAGAGCGACGCCGGT
GACTCGACCGAGCTTCTCGGCGACCTCGTCACCCTCAAAGACAAGGACCTCACCCCCGTCGGCAAGGACATCAAGAAGATGCTTCAGGGCAAAGGCGACCCAGAGTCTAATGACCGCTAC
AGCAAGGTGCCCGACCTGACCTCGGACAAGTGCAAAAAGGACACCTGCTGCGTCTGGCGCTACGTCGCCGATGACATGTACCAGTTCATGGCCGGCAAGTCGGGTCGCTGTACAGGTCTG
GCCCGCGCCGCCGTCCGCCTCGGCTTTCACGACGCCGGGACCTGGTCCAAGGCTACGGCGTCCCAGGGCGGCGGCGCAGACGGCAGCATCCTGCTTGCCCCCGGCGAGATTGATCGCTTC
GAGAACCGTGGTCTGCAGGAGATTGCCGTCAAGTTCCGGGAGCTGTACGGCAAGTACAAGGGTATGGGCTGGGATATTGGCATGGGCGACTTCATCCAA
ATGGGCGCCAACGTCGCAACA
GTAGTCTGTCCCCTCGGCCCGCGCATCAAGTCCTACGTCGGCCGCAAAGACAGCGCCAACGGCTCCCCTGGCGGCCTCCTCCCGAGCCCCTTCCAGCCCGCCGACCAGCTCATTCAGCTC
TTCCGCGACAAGACCATCGGCCCGCACGGTCTCGTCGCCTTGCTCGGCGCGCACACTACTAGCCAGCAGAACTTTGTCAACACAACCCGCGCTGGTGACCCCCAGGACAGCACACCTGGT
GTCTGGGATGTGCTCTACTACAAGGAGACTCTCAGCTCCAACTCGCCGCCTCGCGTCTTCAAGTTCCCCAGCGACATTGCCATCTCCCAGCACCCCGAGACGGCCAAGGAGTTCAAGGAG
TTTGCTGGCCCTGGCGGACAGAACCACTGGAACGAG
GATTACGCTCGTGAATATATCCGTCTCTCTCTTCTGGGCGTCAACAACATCAACCAGCTCACCGAGTGCACCAAGGTCTTGCCC
CCTGCTGTGAACGGTTTCCGCGCCGTTGATCAGTACAAGCTCGACAAGTGGCTCAACAGCGTCGGCAACAAGGGCGCTGCGAAGAAGGTTGCCGAGGATATCGAGAAGGGCGAGCCTGCG
TCTGTTGAGGTTCCCCCTGTCAACAACCGCAACTAA

Retrieve as FASTA