Entry information : CfioCIIAA02_PJ7
Entry ID 13158
Creation 2015-04-20 (Christophe Dunand)
Last sequence changes 2017-05-22 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-05-22 (Catherine Mathe)
Peroxidase information: CfioCIIAA02_PJ7
Name CfioCIIAA02_PJ7
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum fioriniae (Glomerella acutata)    [TaxId: 710243 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CfioCIIAA02_PJ7
start..stop
S start..stop
CfioCIIAA02_MH18 868 0 1..422 1..422
CgraCIIAA02 705 0 1..422 1..421
CgloCIIAA02_Naragc5 699 0 1..422 1..423
CgloCIIAA02_ST23 697 0 1..422 1..423
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..623 623 N° 2 680..1325 646  
join(1..623,680..1325)


exon

Literature and cross-references CfioCIIAA02_PJ7
Literature Baroncelli,R., Sreenivasaprasad,S., Sukno,S.A., Thon,M.R. and Holub,E. Draft Genome Sequence of Colletotrichum acutatum Sensu Lato (Colletotrichum fioriniae). Genome Announc 2 (2) (2014)
DNA ref. GenBank:   NW_006888871.1 (128918..127594)
Cluster/Prediction ref. Genebank:   19032004
Protein sequence: CfioCIIAA02_PJ7
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   422
PWM (Da):   %s   45469.88  
PI (pH):   %s   6.26
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRVSTFLTTALAATPIIAYPGMKNTFAEIRSRADVDGNGADDGDSNELIGDLITLDDSKLTPVGGSVKKLLTGFDNPESDDAYPTVGRSGTLAPKGSAACAADTCCIWKYIANDLQGTFRGRSGRCTDFARAAVRLGFHDAGGWSKGTGNLGGADGSIILASEEMARGENHGLEEIVAQTQVWFDRYKQFGIGMADLIQFSATVATVVCPLGPRIRTYVGRKDSSVPAPLNLLPPVTGSADFLIELFENKTIKPHGLTALIGAHTTSQQRFVDPSRAGDPQDSTPGVWDVKFYKETLGSAPARVFKFASDVVLSKDSRISSEFQAFAGQGGQSHWNQDYAREYIRLSLLGVFNINDLTECTKALPPRTGSTFTAPDQAVLDKWLATKDRLNNIADQLRNGGDINGMIASVMSWLKGVFHFRW*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTGTGTCAACTTTCCTTACTACCGCGCTCGCGGCCACGCCCATCATCGCCTACCCCGGCATGAAGAACACATTCGCCGAGATCCGCTCCCGCGCCGATGTAGACGGCAACGGCGCT
GACGACGGAGACTCTAACGAGCTCATTGGCGATCTCATCACCCTCGACGACTCCAAGCTCACTCCTGTTGGAGGCAGCGTCAAGAAGCTCCTTACCGGTTTTGATAACCCCGAGAGTGAC
GACGCCTACCCAACCGTCGGAAGATCAGGCACCCTTGCACCAAAGGGTTCAGCGGCTTGCGCTGCTGATACCTGCTGCATCTGGAAGTACATCGCCAACGATCTTCAGGGTACCTTCAGA
GGCAGATCCGGCCGTTGCACCGACTTCGCCCGCGCTGCCGTCCGTCTTGGCTTCCACGATGCCGGCGGCTGGTCAAAGGGAACCGGAAACCTCGGCGGAGCTGACGGCTCCATCATTCTC
GCTTCAGAAGAAATGGCACGCGGGGAGAACCACGGTCTCGAGGAGATTGTTGCCCAGACCCAGGTCTGGTTCGACCGGTATAAGCAGTTTGGAATCGGAATGGCCGATCTCATCCAGTTC
TCTGCAACTGTAGCCACTGTCGT
GTAAGTCATCCGGACCTATGGTCTCACAACCTGAGCGTGAACTGATTTCGTGACAGCTGCCCCTTGGGTCCTCGCATTCGCACATACGTCGGCCGCA
AGGACTCCTCTGTCCCTGCTCCCCTTAACCTTCTGCCTCCCGTCACCGGCTCTGCCGACTTCTTGATCGAGCTCTTTGAGAACAAGACCATCAAGCCCCACGGCCTCACCGCACTCATCG
GCGCCCACACGACCAGCCAGCAGCGCTTCGTGGACCCCAGCCGCGCCGGCGACCCGCAGGACAGCACCCCCGGTGTCTGGGACGTCAAGTTCTACAAGGAGACCCTCGGCTCCGCTCCTG
CTCGTGTCTTCAAGTTTGCCAGCGATGTCGTCCTTTCTAAGGACTCCCGCATCAGCTCCGAGTTCCAGGCGTTCGCTGGCCAGGGCGGACAGTCCCACTGGAACCAGGACTACGCTCGCG
AGTATATCCGTCTCTCTCTTCTTGGTGTCTTCAACATCAACGACTTGACTGAGTGCACCAAGGCCCTGCCTCCTCGTACCGGAAGCACCTTCACCGCTCCCGACCAGGCTGTTTTGGACA
AATGGCTCGCCACCAAGGACCGCCTTAACAACATCGCCGATCAACTCAGGAACGGTGGCGACATCAATGGCATGATTGCGTCGGTTATGAGCTGGTTGAAGGGAGTCTTCCACTTCAGGT
GGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTGTGTCAACTTTCCTTACTACCGCGCTCGCGGCCACGCCCATCATCGCCTACCCCGGCATGAAGAACACATTCGCCGAGATCCGCTCCCGCGCCGATGTAGACGGCAACGGCGCT
GACGACGGAGACTCTAACGAGCTCATTGGCGATCTCATCACCCTCGACGACTCCAAGCTCACTCCTGTTGGAGGCAGCGTCAAGAAGCTCCTTACCGGTTTTGATAACCCCGAGAGTGAC
GACGCCTACCCAACCGTCGGAAGATCAGGCACCCTTGCACCAAAGGGTTCAGCGGCTTGCGCTGCTGATACCTGCTGCATCTGGAAGTACATCGCCAACGATCTTCAGGGTACCTTCAGA
GGCAGATCCGGCCGTTGCACCGACTTCGCCCGCGCTGCCGTCCGTCTTGGCTTCCACGATGCCGGCGGCTGGTCAAAGGGAACCGGAAACCTCGGCGGAGCTGACGGCTCCATCATTCTC
GCTTCAGAAGAAATGGCACGCGGGGAGAACCACGGTCTCGAGGAGATTGTTGCCCAGACCCAGGTCTGGTTCGACCGGTATAAGCAGTTTGGAATCGGAATGGCCGATCTCATCCAGTTC
TCTGCAACTGTAGCCACTGTCGT
CTGCCCCTTGGGTCCTCGCATTCGCACATACGTCGGCCGCAAGGACTCCTCTGTCCCTGCTCCCCTTAACCTTCTGCCTCCCGTCACCGGCTCTGCC
GACTTCTTGATCGAGCTCTTTGAGAACAAGACCATCAAGCCCCACGGCCTCACCGCACTCATCGGCGCCCACACGACCAGCCAGCAGCGCTTCGTGGACCCCAGCCGCGCCGGCGACCCG
CAGGACAGCACCCCCGGTGTCTGGGACGTCAAGTTCTACAAGGAGACCCTCGGCTCCGCTCCTGCTCGTGTCTTCAAGTTTGCCAGCGATGTCGTCCTTTCTAAGGACTCCCGCATCAGC
TCCGAGTTCCAGGCGTTCGCTGGCCAGGGCGGACAGTCCCACTGGAACCAGGACTACGCTCGCGAGTATATCCGTCTCTCTCTTCTTGGTGTCTTCAACATCAACGACTTGACTGAGTGC
ACCAAGGCCCTGCCTCCTCGTACCGGAAGCACCTTCACCGCTCCCGACCAGGCTGTTTTGGACAAATGGCTCGCCACCAAGGACCGCCTTAACAACATCGCCGATCAACTCAGGAACGGT
GGCGACATCAATGGCATGATTGCGTCGGTTATGAGCTGGTTGAAGGGAGTCTTCCACTTCAGGTGGTAA

Retrieve as FASTA