Entry information : CfioCIIAA03_PJ7
Entry ID 13159
Creation 2015-04-20 (Christophe Dunand)
Last sequence changes 2015-04-20 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2017-05-02 (Catherine Mathe)
Peroxidase information: CfioCIIAA03_PJ7
Name CfioCIIAA03_PJ7
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum fioriniae (Glomerella acutata)    [TaxId: 710243 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CfioCIIAA03_PJ7
start..stop
S start..stop
CfioCIIAA03_MH18 830 0 1..403 1..403
ChigCIIAA03 696 0 1..403 1..403
CgraCIIAA03 681 0 1..403 1..403
CgloCIIAA01_Naragc5 551 0 1..402 1..401
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 290..1288 999 N° 2 1..213 213  
complement(join(1..213,290..1288))


exon

Literature and cross-references CfioCIIAA03_PJ7
Literature Baroncelli,R., Sreenivasaprasad,S., Sukno,S.A., Thon,M.R. and Holub,E. Draft Genome Sequence of Colletotrichum acutatum Sensu Lato (Colletotrichum fioriniae). Genome Announc 2 (2) (2014)
DNA ref. GenBank:   NW_006888749.1 (181427..180140)
Cluster/Prediction ref. Genebank:   19029910
Protein sequence: CfioCIIAA03_PJ7
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   403 (386)
PWM (Da):   %s   43371.66 (41744.7)  
PI (pH):   %s   5.97 (5.56) Peptide Signal:   %s   cut: 18 range:18-403
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTTSLVTAALAGVVIARPGLDINKMMADAKLEARQADGGGPSTELIGDLATLRGRELTATGQAIKDILTAEAPGQDLKSFYDDSDLPPKNSAECREDDCCIWKYIADDMAAQMVGNAGRCNNVARGAIRLGFHDAASWSKSTGGTGADGSIILANECKTRSDNKGLEEICDIMERWFAKYKKYKISMADLIQTASNVATVSCPLGPRVRTFVGRKDSTTPAVKKLLPDPSDSSAKLFKLFADKSFTPAGLVALMGAHSTSQQRFVDPSRADSPQDSTPGTWDIAYYQQTLNPNAPPAVFKFQSDINVSQDPRTNGVWKAFAAGPRGQFMWNEAYATEYVRMSLLGVNNINDLTECTKALPPFRPGFQQPDEDLLTKVMGSVINSDAIKQALEKGDKIPPNAI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACCACATCCCTCGTCACTGCAGCCTTAGCCGGCGTTGTGATTGCTCGTCCTGGTTTGGATATCAATAAGATGATGGCCGATGCCAAGCTCGAGGCTCGCCAAGCGGACGGTGGC
GGCCCTTCGACAGAGCTCATTGGCGATCTTGCCACGCTCCGAGGCCGCGAACTCACTGCGACCGGTCAGGCAATCAAGGATATATTGACTGCCGAGGCTCCAGGCCAGGACCTGAAGAGT
TTTTACGATGACTCCGATCTTCCGCCAAAGAACTCGGCGGAGTGCAGAGAAGACGATTGCTGCATCTGGAAGTACATTGCCGACGATATGGCCGCACAGATGGTGGGCAATGCCGGCCGT
TGCAACAATGTCGCTCGTGGTGCTATTCGCCTGGGTTTCCACGACGCGGCGTCTTGGTCCAAATCTACCGGCGGCACTGGCGCCGATGGCTCCATCATCCTTGCCAACGAGTGCAAGACG
CGTTCCGACAATAAAGGTCTGGAGGAGATCTGCGATATCATGGAGCGCTGGTTTGCCAAGTACAAAAAGTACAAGATCTCCATGGCCGATTTGATCCAGACTGCCTCCAACGTTGCCACC
GTCTCCTGTCCCCTGGGACCCCGAGTCCGCACCTTTGTTGGTCGCAAAGACTCAACGACGCCCGCGGTGAAGAAGCTCTTGCCGGATCCATCCGACAGCTCAGCCAAGCTGTTCAAGCTC
TTTGCAGACAAATCCTTCACGCCAGCGGGCCTCGTCGCCCTGATGGGCGCGCACAGCACCAGCCAGCAACGCTTCGTTGATCCCTCGCGGGCCGACTCACCCCAAGACAGTACGCCAGGA
ACTTGGGATATCGCCTACTACCAGCAGACGCTCAACCCCAATGCCCCCCCTGCTGTCTTCAAGTTCCAGAGCGACATCAACGTTTCCCAGGATCCGCGCACCAATGGGGTCTGGAAGGCA
TTCGCAGCGGGGCCGCGCGGTCAGTTCATGTGGAACGAG
GTAAGACTTTACCTGACGGCGTCACACGTTCGTCCCAACTCAATAGACTTCCCGAGGCTAACAACCTAAACCTTAGGCGTA
TGCGACAGAATACGTTCGCATGTCTCTGCTCGGCGTTAACAATATCAACGACTTGACCGAATGCACCAAGGCCCTGCCGCCTTTCCGCCCGGGCTTCCAGCAGCCTGATGAAGACCTGTT
GACTAAGGTCATGGGAAGCGTCATCAACTCTGACGCCATTAAGCAGGCCCTCGAAAAGGGTGACAAGATTCCTCCCAATGCCATATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACCACATCCCTCGTCACTGCAGCCTTAGCCGGCGTTGTGATTGCTCGTCCTGGTTTGGATATCAATAAGATGATGGCCGATGCCAAGCTCGAGGCTCGCCAAGCGGACGGTGGC
GGCCCTTCGACAGAGCTCATTGGCGATCTTGCCACGCTCCGAGGCCGCGAACTCACTGCGACCGGTCAGGCAATCAAGGATATATTGACTGCCGAGGCTCCAGGCCAGGACCTGAAGAGT
TTTTACGATGACTCCGATCTTCCGCCAAAGAACTCGGCGGAGTGCAGAGAAGACGATTGCTGCATCTGGAAGTACATTGCCGACGATATGGCCGCACAGATGGTGGGCAATGCCGGCCGT
TGCAACAATGTCGCTCGTGGTGCTATTCGCCTGGGTTTCCACGACGCGGCGTCTTGGTCCAAATCTACCGGCGGCACTGGCGCCGATGGCTCCATCATCCTTGCCAACGAGTGCAAGACG
CGTTCCGACAATAAAGGTCTGGAGGAGATCTGCGATATCATGGAGCGCTGGTTTGCCAAGTACAAAAAGTACAAGATCTCCATGGCCGATTTGATCCAGACTGCCTCCAACGTTGCCACC
GTCTCCTGTCCCCTGGGACCCCGAGTCCGCACCTTTGTTGGTCGCAAAGACTCAACGACGCCCGCGGTGAAGAAGCTCTTGCCGGATCCATCCGACAGCTCAGCCAAGCTGTTCAAGCTC
TTTGCAGACAAATCCTTCACGCCAGCGGGCCTCGTCGCCCTGATGGGCGCGCACAGCACCAGCCAGCAACGCTTCGTTGATCCCTCGCGGGCCGACTCACCCCAAGACAGTACGCCAGGA
ACTTGGGATATCGCCTACTACCAGCAGACGCTCAACCCCAATGCCCCCCCTGCTGTCTTCAAGTTCCAGAGCGACATCAACGTTTCCCAGGATCCGCGCACCAATGGGGTCTGGAAGGCA
TTCGCAGCGGGGCCGCGCGGTCAGTTCATGTGGAACGAG
GCGTATGCGACAGAATACGTTCGCATGTCTCTGCTCGGCGTTAACAATATCAACGACTTGACCGAATGCACCAAGGCCCTG
CCGCCTTTCCGCCCGGGCTTCCAGCAGCCTGATGAAGACCTGTTGACTAAGGTCATGGGAAGCGTCATCAACTCTGACGCCATTAAGCAGGCCCTCGAAAAGGGTGACAAGATTCCTCCC
AATGCCATATAG

Retrieve as FASTA