Entry information : CfioCP01_PJ7
Entry ID 13162
Creation 2015-04-21 (Christophe Dunand)
Last sequence changes 2015-04-21 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-04-21 (Christophe Dunand)
Peroxidase information: CfioCP01_PJ7
Name CfioCP01_PJ7
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum fioriniae (Glomerella acutata)    [TaxId: 710243 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CfioCP01_PJ7
start..stop
S start..stop
CfioCP01_MH18 1553 0 1..757 1..757
ChigCP01 1410 0 1..757 1..760
CgraCP01 1407 0 1..757 1..758
CgloCP02_Naragc5 1320 0 1..757 1..757
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..330 330 N° 2 399..2342 1944  
join(1..330,399..2342)


exon

Literature and cross-references CfioCP01_PJ7
Literature Baroncelli,R., Sreenivasaprasad,S., Sukno,S.A., Thon,M.R. and Holub,E. Draft Genome Sequence of Colletotrichum acutatum Sensu Lato (Colletotrichum fioriniae). Genome Announc 2 (2) (2014)
DNA ref. GenBank:   NW_006889734.1 (218756..221097)
Cluster/Prediction ref. Genebank:   19033622
Protein sequence: CfioCP01_PJ7
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   757
PWM (Da):   %s   82757.24  
PI (pH):   %s   5.98
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAEEKCPFIRTMNTGGGGTKNRDWWPDSLKLNILRQHTPVTNPLGGDFDYVSAFKTLDYDGVKKDLTALMTDSQDWWPADFGHYGGLFIRMAWHSAGTYRVHDGRGGGGEGQQRFAPLNSWPDNVSLDKARRLLWPIKQKYGNKISWADLMILAGNVALESMGFQTAGFSGGRPDTWEADDSVYWGGETTWLGNDVRYSHGHEGKAEPGVLDGSQDTKSKSDIHTRDLESPLGAAHMGLIYVNPEGPDGNPDPVAAARDIRVTFGRMAMNDEETVALIAGGHTFGKTHGAAPDSNVGAEPEASGLEAQGFGWANKHGTGKGADTITSGLEVTWTATPTKWSNKYFEYLFKFDWELTKSPAGANQWVAKNAEPIIPHAFDSSKKQLPTMLTTDLSLRFDPEYEKISRRFLENPDQFADAFAKAWFKLTHRDMGPRSRYVGPEVPSEDFIWQDPIPAPSSPLVSEQDVAALKKEVLATGIDASKLISTAWASASTFRGSDKRGGANGARIRLAPQKDWEVNNPKQLAEVLKALEGVQQKFNGSGKKISLADLIVLAGAAGVEQAAKNAGVDINVPFTPGRGDATQEQTDVESVDHLQPYADGFRNYGKSSNRAKTEHYLVDKAHLLTLTAPELTVLVGGLRVLNTNFDGSSTGVFTNRPGALTNDFFVNLLDMGNEWKATNNQDVYEGFDRKSGSKKYTASRVDLVFGSHAELRAVAEIYAQADAGQKFVKDFVTVWDKVMNLDRFDLKKQSGSVPSRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGGAAAAGTGTCCCTTCATTCGGACCATGAACACCGGAGGTGGCGGCACAAAGAACCGCGACTGGTGGCCCGATTCCCTTAAGCTCAACATCCTCCGCCAGCACACTCCCGTC
ACCAACCCGTTAGGTGGTGACTTTGACTACGTGTCTGCCTTCAAGACCCTCGACTACGATGGCGTCAAGAAGGACCTCACGGCTCTGATGACCGACTCTCAAGATTGGTGGCCTGCCGAT
TTTGGCCATTACGGAGGTCTCTTCATTCGTATGGCATGGCACAGCGCCGGTACCTACCGTGTTCATGACGGCCGTGGCGGCGGTGGTGAG
GTAAGTTGATCCGGGAAACTAAACGGATCA
TCATTGGTAGACGAGGTGCTAATTATTGCGCCTTACAGGGTCAGCAACGTTTTGCCCCTCTCAACAGTTGGCCTGACAATGTCAGTCTCGACAAGGCCCGTCGCTTGTTATGGCCCATTA
AGCAAAAGTACGGCAACAAGATCTCCTGGGCCGATCTTATGATCTTGGCTGGCAACGTTGCCCTCGAGTCAATGGGCTTCCAGACTGCTGGTTTCTCTGGCGGACGTCCCGACACCTGGG
AGGCTGATGACTCCGTTTACTGGGGCGGCGAGACCACATGGCTTGGCAACGACGTCCGCTACTCCCACGGTCACGAAGGGAAGGCCGAGCCGGGCGTCCTCGACGGCTCTCAGGACACCA
AGAGCAAGTCAGACATTCACACCCGCGACCTGGAGTCACCACTTGGTGCCGCCCATATGGGTCTCATTTATGTGAACCCTGAGGGTCCCGACGGCAACCCCGACCCAGTCGCCGCTGCTA
GAGACATTCGCGTCACTTTCGGACGCATGGCTATGAATGACGAGGAGACGGTGGCTCTCATCGCTGGTGGTCACACTTTCGGCAAGACCCACGGTGCTGCTCCCGACAGCAACGTTGGTG
CCGAGCCCGAGGCCTCTGGTCTCGAGGCTCAGGGCTTTGGCTGGGCCAACAAGCACGGTACCGGCAAGGGCGCGGATACCATCACCAGTGGTCTGGAGGTTACTTGGACTGCTACTCCCA
CCAAGTGGAGCAACAAGTACTTCGAGTACCTATTCAAATTTGACTGGGAGCTCACCAAGAGTCCCGCTGGTGCTAACCAGTGGGTGGCAAAGAACGCCGAGCCCATCATCCCCCATGCCT
TCGACTCCAGCAAGAAGCAGCTTCCCACCATGTTGACGACCGACTTGTCGCTGCGCTTCGACCCCGAATATGAGAAGATCTCGAGACGCTTCCTCGAAAACCCGGATCAGTTCGCCGATG
CATTCGCCAAGGCCTGGTTCAAGCTCACCCACCGTGACATGGGCCCGCGCTCCCGCTATGTTGGACCCGAGGTTCCCTCTGAGGATTTCATCTGGCAGGACCCCATCCCTGCTCCCAGCT
CGCCCCTCGTCAGCGAGCAGGACGTTGCTGCCCTCAAGAAGGAGGTTCTCGCCACTGGCATTGATGCCTCCAAGCTCATCTCCACTGCTTGGGCTTCAGCCTCTACCTTCCGTGGAAGCG
ACAAGCGTGGTGGTGCCAACGGCGCCCGTATTCGCTTGGCGCCCCAGAAGGACTGGGAGGTCAACAACCCCAAGCAGCTCGCCGAGGTTCTCAAGGCCCTCGAGGGTGTGCAGCAGAAGT
TCAACGGTTCGGGCAAGAAGATCTCTTTGGCTGATCTCATTGTCCTCGCCGGTGCTGCTGGTGTCGAGCAGGCAGCCAAGAATGCGGGCGTCGACATTAACGTGCCCTTCACCCCTGGTC
GTGGCGATGCTACCCAGGAGCAGACCGACGTTGAGTCTGTTGACCACCTTCAGCCCTACGCCGATGGATTCCGCAACTACGGCAAGTCCAGCAACCGTGCGAAGACCGAGCACTACCTTG
TCGACAAGGCACACCTACTAACGCTCACCGCTCCTGAGCTCACCGTTCTCGTTGGTGGCCTGCGTGTGCTGAACACCAACTTTGATGGCTCGTCAACTGGTGTATTCACCAACCGCCCCG
GCGCCTTGACCAATGACTTCTTCGTCAACTTGCTCGACATGGGCAACGAGTGGAAGGCCACCAACAATCAAGATGTCTACGAGGGCTTCGATCGCAAGTCAGGCTCCAAGAAGTACACTG
CCAGCCGTGTCGACCTTGTCTTTGGCTCTCACGCTGAGCTCCGCGCTGTTGCGGAGATCTACGCCCAGGCTGATGCCGGCCAGAAGTTCGTCAAGGACTTCGTGACCGTTTGGGACAAGG
TCATGAACCTGGACCGCTTTGATCTTAAGAAGCAGTCCGGTAGTGTGCCGAGCCGCCTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGGAAAAGTGTCCCTTCATTCGGACCATGAACACCGGAGGTGGCGGCACAAAGAACCGCGACTGGTGGCCCGATTCCCTTAAGCTCAACATCCTCCGCCAGCACACTCCCGTC
ACCAACCCGTTAGGTGGTGACTTTGACTACGTGTCTGCCTTCAAGACCCTCGACTACGATGGCGTCAAGAAGGACCTCACGGCTCTGATGACCGACTCTCAAGATTGGTGGCCTGCCGAT
TTTGGCCATTACGGAGGTCTCTTCATTCGTATGGCATGGCACAGCGCCGGTACCTACCGTGTTCATGACGGCCGTGGCGGCGGTGGTGAG
GGTCAGCAACGTTTTGCCCCTCTCAACAGT
TGGCCTGACAATGTCAGTCTCGACAAGGCCCGTCGCTTGTTATGGCCCATTAAGCAAAAGTACGGCAACAAGATCTCCTGGGCCGATCTTATGATCTTGGCTGGCAACGTTGCCCTCGAG
TCAATGGGCTTCCAGACTGCTGGTTTCTCTGGCGGACGTCCCGACACCTGGGAGGCTGATGACTCCGTTTACTGGGGCGGCGAGACCACATGGCTTGGCAACGACGTCCGCTACTCCCAC
GGTCACGAAGGGAAGGCCGAGCCGGGCGTCCTCGACGGCTCTCAGGACACCAAGAGCAAGTCAGACATTCACACCCGCGACCTGGAGTCACCACTTGGTGCCGCCCATATGGGTCTCATT
TATGTGAACCCTGAGGGTCCCGACGGCAACCCCGACCCAGTCGCCGCTGCTAGAGACATTCGCGTCACTTTCGGACGCATGGCTATGAATGACGAGGAGACGGTGGCTCTCATCGCTGGT
GGTCACACTTTCGGCAAGACCCACGGTGCTGCTCCCGACAGCAACGTTGGTGCCGAGCCCGAGGCCTCTGGTCTCGAGGCTCAGGGCTTTGGCTGGGCCAACAAGCACGGTACCGGCAAG
GGCGCGGATACCATCACCAGTGGTCTGGAGGTTACTTGGACTGCTACTCCCACCAAGTGGAGCAACAAGTACTTCGAGTACCTATTCAAATTTGACTGGGAGCTCACCAAGAGTCCCGCT
GGTGCTAACCAGTGGGTGGCAAAGAACGCCGAGCCCATCATCCCCCATGCCTTCGACTCCAGCAAGAAGCAGCTTCCCACCATGTTGACGACCGACTTGTCGCTGCGCTTCGACCCCGAA
TATGAGAAGATCTCGAGACGCTTCCTCGAAAACCCGGATCAGTTCGCCGATGCATTCGCCAAGGCCTGGTTCAAGCTCACCCACCGTGACATGGGCCCGCGCTCCCGCTATGTTGGACCC
GAGGTTCCCTCTGAGGATTTCATCTGGCAGGACCCCATCCCTGCTCCCAGCTCGCCCCTCGTCAGCGAGCAGGACGTTGCTGCCCTCAAGAAGGAGGTTCTCGCCACTGGCATTGATGCC
TCCAAGCTCATCTCCACTGCTTGGGCTTCAGCCTCTACCTTCCGTGGAAGCGACAAGCGTGGTGGTGCCAACGGCGCCCGTATTCGCTTGGCGCCCCAGAAGGACTGGGAGGTCAACAAC
CCCAAGCAGCTCGCCGAGGTTCTCAAGGCCCTCGAGGGTGTGCAGCAGAAGTTCAACGGTTCGGGCAAGAAGATCTCTTTGGCTGATCTCATTGTCCTCGCCGGTGCTGCTGGTGTCGAG
CAGGCAGCCAAGAATGCGGGCGTCGACATTAACGTGCCCTTCACCCCTGGTCGTGGCGATGCTACCCAGGAGCAGACCGACGTTGAGTCTGTTGACCACCTTCAGCCCTACGCCGATGGA
TTCCGCAACTACGGCAAGTCCAGCAACCGTGCGAAGACCGAGCACTACCTTGTCGACAAGGCACACCTACTAACGCTCACCGCTCCTGAGCTCACCGTTCTCGTTGGTGGCCTGCGTGTG
CTGAACACCAACTTTGATGGCTCGTCAACTGGTGTATTCACCAACCGCCCCGGCGCCTTGACCAATGACTTCTTCGTCAACTTGCTCGACATGGGCAACGAGTGGAAGGCCACCAACAAT
CAAGATGTCTACGAGGGCTTCGATCGCAAGTCAGGCTCCAAGAAGTACACTGCCAGCCGTGTCGACCTTGTCTTTGGCTCTCACGCTGAGCTCCGCGCTGTTGCGGAGATCTACGCCCAG
GCTGATGCCGGCCAGAAGTTCGTCAAGGACTTCGTGACCGTTTGGGACAAGGTCATGAACCTGGACCGCTTTGATCTTAAGAAGCAGTCCGGTAGTGTGCCGAGCCGCCTTTAG

Retrieve as FASTA