Entry information : CfioCP02_PJ7
Entry ID 13163
Creation 2015-04-21 (Christophe Dunand)
Last sequence changes 2015-04-21 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-04-21 (Christophe Dunand)
Peroxidase information: CfioCP02_PJ7
Name CfioCP02_PJ7
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum fioriniae (Glomerella acutata)    [TaxId: 710243 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CfioCP02_PJ7
start..stop
S start..stop
CfioCP02_MH18 1592 0 1..777 1..777
CgloCP01_ST23 1401 0 1..775 1..775
CgraCP02 1347 0 1..776 1..776
CgloCP01_Naragc5 1298 0 1..775 1..761
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..298 298 N° 2 371..525 155 N° 3 972..1044 73 N° 4 1232..1663 432
N° 5 1829..1964 136 N° 6 2245..3484 1240  
join(1..298,371..525,972..1044,1232..1663,1829..1964,2245..3484)


exon

Literature and cross-references CfioCP02_PJ7
Literature Baroncelli,R., Sreenivasaprasad,S., Sukno,S.A., Thon,M.R. and Holub,E. Draft Genome Sequence of Colletotrichum acutatum Sensu Lato (Colletotrichum fioriniae). Genome Announc 2 (2) (2014)
DNA ref. GenBank:   NW_006889078.1 (366321..369804)
Cluster/Prediction ref. Genebank:   19030484
Protein sequence: CfioCP02_PJ7
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   777 (756)
PWM (Da):   %s   84395.32 (82346.2)  
PI (pH):   %s   5.46 (5.28) Peptide Signal:   %s   cut: 22 range:22-777
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHAKLSSCLLAASALLPAVTAEGCPFAKRDGSVTSELPKRETAEGFGRCSRISNQAGGGTRSHDWWPCQLRLDTLRQFQPATNPYGGDFDYTAAFNSLDYEALKKDLHALMTESQEWWPADFGHYGGLFIRMAWHSAGTYRAIDGRGGGGGQQRFAPLNSWPDNQNLDKARRLLWPIKQKYGNKISWADLYLLTGNVALESMGFTPLGFAAGRPDTWQSDESVYWGGETTFVPKGNDVRYNGSTDINERADKLEKPLGATHMGLIYVNPEGPDASSDPAASAKDIRVAFDRMGMNDEETVALIAGGHAFGKTHGAVPASNIGGEPEAADLGEMGLGWHNSVGDGNGVNQMTSGLEVVWTKTPTKWSNGYLESLIHNKWTLVTSPAGAHQWEAVNGTLDYPDPFDATKFRKATMLTSDLALINDPSYLNITTRWLDHPQELADAFAKAWFKLLHRDLGPVARYLGPEIPKETFGWQDPLPAREGELIDDADVTKLKSDILGTAGLDVSKLASVAWASASTFRHSDKRGGANGARIALEPQNKWVSNNPTVLTEVIDALKKIQTSFNTGAKKVSLADLIVLGGVAAVEKAASDAGVAVTVPFTAGRVDATQEQTDVRAFSYLEPQADGFRNYGKGTARARTEEILVDKASQLTLSAPELTVLVGGLRALGATFDQSNTGVLTAKKGQLTNDWFINLLDISTVWSKTDTEGETWTGVDRKTKAEKWTATRADLVFGSHAELRAISEVYASSDANEKFVKDFVAAWDKVMNLDRFDLKKY

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACGCCAAACTTTCAAGCTGCCTTTTGGCAGCTTCTGCTCTCCTGCCCGCCGTCACGGCTGAGGGCTGCCCTTTCGCCAAACGCGATGGTTCCGTCACCAGCGAGCTCCCCAAGAGA
GAGACGGCTGAGGGCTTCGGCCGATGCTCGAGAATCAGCAACCAGGCTGGTGGCGGCACCCGCAGCCACGACTGGTGGCCTTGCCAGCTTAGACTCGATACTCTTCGCCAGTTCCAGCCC
GCGACCAACCCGTACGGAGGCGATTTCGACTACACTGCGGCTTTCAACTCTTTGGATT
GTGAGTAGAATCGATGGGGAGGGGGAAGAAGAAACACTGCATGGGAGGATCCTCACTAACAC
CCCACGTCAGATGAGGCTCTGAAGAAGGACCTCCACGCCCTGATGACGGAGTCCCAGGAATGGTGGCCCGCCGACTTTGGCCACTATGGCGGTCTCTTCATCCGCATGGCCTGGCATAGC
GCCGGCACTTATCGCGCCATTGACGGCCGAGGTGGCGGTGGAATG
GTGAGCCCTTTTTTTCTTCACTGCATCTCTTGGCTTATGTTTTACTTTCTTCTCTTTGGCTGTGTTATCCCGAAA
GTCCTTCCCTCCCTCCCCCCCGCTCTCCCGGTCTTCCTAGTGCTTTTCCACTTGGCACAAGGTAGCTGGAAGAAACACCGCGTTGTAACCCCCCTCTCCATTTTAGCATATTTCTTATTC
CTTGCCTACCGTTGCACTTGATCATCTCTTCGCGGTCCTATTCGTCTCGCGTTGGAAGATCAATTGGCTAGACGGAGGTTTTTGTCCTATCCCGGATCAAAGCCAAGAGGTGCTAAAGCA
TCTCGCTCGCCTTTTTCTCCACCCGCACCGCGTCACGAAATATGGATCTGGGCTGTTTGCATCTTATCACATCTCTGCATCAGTTTAATTCTTCTTGAGGACTGGCGTTTACTAATATTG
GACTCCTGCAGGGCCAACAACGTTTCGCTCCGCTTAACAGCTGGCCTGACAACCAGAACCTCGACAAGGCTCGCCGCCTGCTGTGTAAGATTTCCAGTCCTTATGCGCTCTTTCACGATT
CGGCCCACCCATGTTCGACTTGCATCATCGACTCGGTAGCGATATCCACTTTGCCGTGGCTCGATGGTGCGAGTAGAGCGCTGTTGTGGGCCTCTTGAGAGATAGAGAGAGAAGAAACGT
TTGCTAATCCTAGCTCTTTCACTTTTTACAGGGCCTATCAAGCAAAAGTACGGCAACAAGATCTCATGGGCCGACTTGTACCTCCTCACCGGCAACGTTGCCCTTGAGTCCATGGGCTTC
ACCCCTCTTGGCTTCGCCGCTGGCCGTCCCGATACCTGGCAATCCGATGAGTCCGTCTACTGGGGTGGAGAGACGACCTTCGTCCCCAAGGGTAACGATGTCCGCTACAACGGCAGCACC
GACATCAACGAGCGCGCCGACAAGCTCGAGAAGCCCCTGGGTGCCACCCACATGGGTCTCATCTACGTCAACCCGGAGGGCCCCGATGCCAGCTCCGACCCCGCCGCTTCGGCCAAGGAC
ATCCGCGTCGCTTTCGATCGCATGGGAATGAACGATGAGGAGACCGTCGCTCTGATCGCCGGTGGACACGCCTTTGGCAAGACGCACGGTGCCGTGCCTGCAA
GTGAGTTTGCACATCAT
TCACGCCCCCCATCTTCACGATCCCGGTTCGAGTCGGACGAACGGGCGAGAATTGAGCGCCTCCGGAGAGAGCTCCGGGTTACCCCCGGGAACACGATTTTCACCGCCACTTTTGGAACA
TGCAGATGCTAATCCGCGTCTCTCATAGGCAACATTGGAGGTGAGCCCGAGGCCGCTGACCTTGGCGAGATGGGTCTCGGATGGCACAACAGCGTCGGTGATGGCAACGGTGTCAACCAG
ATGACCAGTGGTCTTGAGGTTGTCTGGACCAAGACCCCTACCAA
GTAAGTGATGATTGTGATGAGTCTATTTCCGTTTGCATTTGCGGCCCCCCCATTCTTGGCACTCCAGTCGTTCTCA
TTTCCCCTCTTCTCACTCTTGAGGCCTCTTTTATCTCTCATTAGCCGAATCTTCGCCCTCGAAAGAGAGAGAGAGAGAGAGAGAGAGAAGGTCATGAGAGAAATGATGAGGCGACAAACG
ACGAGGCCAAGAAAAGCTATTTATACATCAACCACACCGGGTGATTATGCAGTGACACACCGACGCTAATCCTTGTACCTGCAGATGGAGCAACGGCTACTTGGAGTCTCTCATTCACAA
CAAATGGACCCTCGTCACCAGCCCTGCCGGCGCTCACCAATGGGAGGCTGTCAACGGCACTCTCGACTACCCCGATCCCTTTGACGCCACCAAGTTCCGCAAGGCCACCATGCTCACCAG
CGACTTGGCTCTCATCAACGACCCGTCCTACCTCAACATCACCACCCGGTGGCTCGATCACCCCCAGGAGCTCGCCGATGCCTTCGCCAAGGCTTGGTTCAAGCTTCTCCACCGTGACTT
GGGTCCCGTCGCCCGCTACCTCGGTCCCGAGATCCCCAAGGAGACTTTCGGCTGGCAGGATCCCCTTCCCGCTAGGGAGGGTGAGCTCATTGACGATGCCGATGTGACCAAGCTCAAGTC
TGACATTCTTGGTACCGCCGGTCTCGACGTTTCCAAGCTCGCCTCCGTCGCCTGGGCCTCCGCCTCTACCTTCCGTCACTCCGACAAGCGTGGTGGTGCCAACGGTGCCCGCATCGCCCT
CGAGCCCCAGAACAAGTGGGTTTCCAACAACCCTACCGTCCTCACCGAGGTTATCGACGCCCTTAAGAAGATCCAGACCAGCTTCAACACCGGTGCCAAGAAGGTTTCCCTCGCCGACTT
GATCGTTCTCGGTGGTGTCGCCGCCGTCGAGAAGGCCGCTTCTGACGCTGGTGTCGCCGTCACCGTCCCCTTCACCGCCGGCCGTGTCGACGCCACCCAGGAGCAGACCGACGTCCGCGC
TTTCAGCTACCTCGAGCCCCAGGCCGACGGCTTCCGCAACTACGGCAAGGGTACCGCCCGCGCTCGCACTGAGGAGATCCTCGTCGACAAGGCCTCCCAGCTCACCCTCTCCGCCCCCGA
GCTGACCGTCCTCGTCGGTGGTCTCCGCGCCCTCGGCGCCACCTTCGACCAGTCCAACACCGGTGTTCTTACCGCCAAGAAGGGCCAGCTGACCAACGACTGGTTCATCAACCTGCTGGA
TATCTCCACCGTCTGGTCCAAGACCGATACCGAGGGCGAGACCTGGACCGGTGTTGACCGCAAGACCAAGGCCGAGAAGTGGACCGCCACCCGCGCCGATCTCGTGTTCGGATCCCACGC
CGAGCTCCGTGCCATCTCTGAGGTCTACGCCAGCTCTGACGCCAACGAGAAGTTCGTCAAGGACTTCGTCGCTGCGTGGGACAAGGTCATGAACCTTGACCGCTTCGACTTGAAGAAGTA
CTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACGCCAAACTTTCAAGCTGCCTTTTGGCAGCTTCTGCTCTCCTGCCCGCCGTCACGGCTGAGGGCTGCCCTTTCGCCAAACGCGATGGTTCCGTCACCAGCGAGCTCCCCAAGAGA
GAGACGGCTGAGGGCTTCGGCCGATGCTCGAGAATCAGCAACCAGGCTGGTGGCGGCACCCGCAGCCACGACTGGTGGCCTTGCCAGCTTAGACTCGATACTCTTCGCCAGTTCCAGCCC
GCGACCAACCCGTACGGAGGCGATTTCGACTACACTGCGGCTTTCAACTCTTTGGATT
ATGAGGCTCTGAAGAAGGACCTCCACGCCCTGATGACGGAGTCCCAGGAATGGTGGCCCGCC
GACTTTGGCCACTATGGCGGTCTCTTCATCCGCATGGCCTGGCATAGCGCCGGCACTTATCGCGCCATTGACGGCCGAGGTGGCGGTGGAATG
GGCCAACAACGTTTCGCTCCGCTTAAC
AGCTGGCCTGACAACCAGAACCTCGACAAGGCTCGCCGCCTGCTGT
GGCCTATCAAGCAAAAGTACGGCAACAAGATCTCATGGGCCGACTTGTACCTCCTCACCGGCAACGTTGCCCTT
GAGTCCATGGGCTTCACCCCTCTTGGCTTCGCCGCTGGCCGTCCCGATACCTGGCAATCCGATGAGTCCGTCTACTGGGGTGGAGAGACGACCTTCGTCCCCAAGGGTAACGATGTCCGC
TACAACGGCAGCACCGACATCAACGAGCGCGCCGACAAGCTCGAGAAGCCCCTGGGTGCCACCCACATGGGTCTCATCTACGTCAACCCGGAGGGCCCCGATGCCAGCTCCGACCCCGCC
GCTTCGGCCAAGGACATCCGCGTCGCTTTCGATCGCATGGGAATGAACGATGAGGAGACCGTCGCTCTGATCGCCGGTGGACACGCCTTTGGCAAGACGCACGGTGCCGTGCCTGCAA
GC
AACATTGGAGGTGAGCCCGAGGCCGCTGACCTTGGCGAGATGGGTCTCGGATGGCACAACAGCGTCGGTGATGGCAACGGTGTCAACCAGATGACCAGTGGTCTTGAGGTTGTCTGGACC
AAGACCCCTACCAA
ATGGAGCAACGGCTACTTGGAGTCTCTCATTCACAACAAATGGACCCTCGTCACCAGCCCTGCCGGCGCTCACCAATGGGAGGCTGTCAACGGCACTCTCGACTAC
CCCGATCCCTTTGACGCCACCAAGTTCCGCAAGGCCACCATGCTCACCAGCGACTTGGCTCTCATCAACGACCCGTCCTACCTCAACATCACCACCCGGTGGCTCGATCACCCCCAGGAG
CTCGCCGATGCCTTCGCCAAGGCTTGGTTCAAGCTTCTCCACCGTGACTTGGGTCCCGTCGCCCGCTACCTCGGTCCCGAGATCCCCAAGGAGACTTTCGGCTGGCAGGATCCCCTTCCC
GCTAGGGAGGGTGAGCTCATTGACGATGCCGATGTGACCAAGCTCAAGTCTGACATTCTTGGTACCGCCGGTCTCGACGTTTCCAAGCTCGCCTCCGTCGCCTGGGCCTCCGCCTCTACC
TTCCGTCACTCCGACAAGCGTGGTGGTGCCAACGGTGCCCGCATCGCCCTCGAGCCCCAGAACAAGTGGGTTTCCAACAACCCTACCGTCCTCACCGAGGTTATCGACGCCCTTAAGAAG
ATCCAGACCAGCTTCAACACCGGTGCCAAGAAGGTTTCCCTCGCCGACTTGATCGTTCTCGGTGGTGTCGCCGCCGTCGAGAAGGCCGCTTCTGACGCTGGTGTCGCCGTCACCGTCCCC
TTCACCGCCGGCCGTGTCGACGCCACCCAGGAGCAGACCGACGTCCGCGCTTTCAGCTACCTCGAGCCCCAGGCCGACGGCTTCCGCAACTACGGCAAGGGTACCGCCCGCGCTCGCACT
GAGGAGATCCTCGTCGACAAGGCCTCCCAGCTCACCCTCTCCGCCCCCGAGCTGACCGTCCTCGTCGGTGGTCTCCGCGCCCTCGGCGCCACCTTCGACCAGTCCAACACCGGTGTTCTT
ACCGCCAAGAAGGGCCAGCTGACCAACGACTGGTTCATCAACCTGCTGGATATCTCCACCGTCTGGTCCAAGACCGATACCGAGGGCGAGACCTGGACCGGTGTTGACCGCAAGACCAAG
GCCGAGAAGTGGACCGCCACCCGCGCCGATCTCGTGTTCGGATCCCACGCCGAGCTCCGTGCCATCTCTGAGGTCTACGCCAGCTCTGACGCCAACGAGAAGTTCGTCAAGGACTTCGTC
GCTGCGTGGGACAAGGTCATGAACCTTGACCGCTTCGACTTGAAGAAGTACTAA

Retrieve as FASTA