Entry information : CfioAPx-CcP01_PJ7
Entry ID 13164
Creation 2015-04-21 (Christophe Dunand)
Last sequence changes 2015-04-21 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-04-21 (Christophe Dunand)
Peroxidase information: CfioAPx-CcP01_PJ7
Name CfioAPx-CcP01_PJ7
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum fioriniae (Glomerella acutata)    [TaxId: 710243 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CfioAPx-CcP01_PJ7
start..stop
S start..stop
CfioAPx-CcP01_MH18 1096 0 1..536 1..536
CgloAPx-CcP03_ST23 919 0 1..536 1..539
CgloAPx-CcP03_Naragc5 919 0 1..536 1..539
CorbiAPx-CcP1 918 0 1..536 1..539
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..136 136 N° 2 189..1663 1475  
join(1..136,189..1663)


exon

Literature and cross-references CfioAPx-CcP01_PJ7
Literature Baroncelli,R., Sreenivasaprasad,S., Sukno,S.A., Thon,M.R. and Holub,E. Draft Genome Sequence of Colletotrichum acutatum Sensu Lato (Colletotrichum fioriniae). Genome Announc 2 (2) (2014)
DNA ref. GenBank:   NW_006888783.1 (118111..119773)
Cluster/Prediction ref. Genebank:   19035844
Protein sequence: CfioAPx-CcP01_PJ7
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   536 (520)
PWM (Da):   %s   57603.3 (55976.4)  
PI (pH):   %s   4.52 (4.48) Peptide Signal:   %s   cut: 23 range:17-536
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRQSILSTLALASIAATEYVWPSQYDELEDHLSLQSGYLRRGFIDGVITCGFGTSIPGRQNSAEWIRAAFHDMATHDAATGTGGLDASIFFELDRPENIGGAFNNTFGFFSSFHSIRASASDLLAMSVLVASFACGGIQIPFRAGRIDAQEAGPAGVPEPQTDLNTTQQAFTKAGFSQSDMIAMVACGHTLGGVHSMDFPEIVGVAADPNNDTVAHFDTEFAKFDNVVVTEYLDGTTKNPLVVGTNDTLNSDKRIFAADGNKTMQAMADPDAFQATCADIFSRMIDTVPANVKLSDPIVATDIKPYISGLFLKDDGNLSFGGRIRIRTTAVTGRDPNDLSVQLTYADRNGNGSTVITTRKATFQGGSASGLWRESFYWWEFDTVISPDTGISKFYIHVTKPSTNETITYDNAGNGYPMSDVLLYQQSKSCIGNVADGKLPVTVKALIRKDRVPATADGLTMDLVHEVRRQGVIVPRLEVEKINFQATGEDQGQWSIYTASGSVDADGWNTSFDIKLGGEDPTEVAFQKTGALSSCS

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). WSC domain-containing protein
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGCAGAGCATTCTCTCCACGCTCGCTCTGGCGTCCATCGCCGCGACGGAGTATGTTTGGCCTTCTCAGTACGATGAGCTCGAGGATCATCTCTCTCTCCAGTCCGGATACCTTCGA
AGAGGCTTCATCGATG
GTCAGTTGCATTTCTGCCACGGAACATTGATCAACTACTGACAAGCCATTAGGCGTTATTACGTGCGGGTTCGGCACAAGCATTCCAGGCCGCCAGAACTCTGC
TGAATGGATCCGCGCCGCTTTCCACGACATGGCTACGCATGATGCTGCCACTGGCACTGGTGGCTTGGATGCGTCCATCTTCTTCGAGTTGGACCGCCCAGAGAATATCGGAGGCGCCTT
CAACAACACCTTCGGATTCTTCAGCAGCTTCCACTCCATCCGCGCCTCTGCTTCTGATTTGTTGGCCATGAGTGTCCTCGTCGCCAGCTTTGCTTGCGGCGGGATCCAAATCCCGTTCCG
TGCCGGCCGTATTGACGCTCAAGAGGCCGGCCCTGCCGGTGTCCCGGAGCCTCAGACCGATCTCAACACTACCCAGCAGGCTTTCACCAAGGCAGGCTTCTCTCAGAGCGACATGATTGC
CATGGTTGCATGCGGTCATACTCTTGGAGGTGTACACAGCATGGACTTCCCCGAGATCGTCGGCGTCGCGGCGGACCCCAATAACGACACCGTAGCGCACTTCGATACCGAATTTGCAAA
GTTCGACAACGTCGTCGTGACTGAATATCTGGATGGCACAACCAAGAACCCTCTGGTTGTTGGCACAAACGATACCCTCAACTCAGACAAGCGTATCTTCGCTGCAGATGGAAACAAGAC
GATGCAAGCCATGGCCGACCCTGACGCTTTCCAGGCTACCTGCGCCGATATCTTCAGTCGTATGATTGATACTGTCCCCGCCAACGTTAAGCTCAGCGACCCCATCGTAGCCACAGACAT
TAAGCCCTACATCAGCGGGCTCTTCCTCAAGGACGACGGCAACCTGTCCTTCGGCGGCCGCATTCGCATCCGCACCACCGCGGTCACTGGCCGGGATCCTAATGATCTCTCGGTTCAGCT
GACGTACGCTGACCGCAACGGCAACGGATCAACCGTCATTACTACCCGTAAGGCGACCTTCCAAGGTGGTAGCGCCTCTGGCTTATGGAGGGAGAGCTTCTACTGGTGGGAGTTCGACAC
CGTGATCAGCCCTGACACGGGCATCAGCAAGTTCTACATCCACGTTACGAAGCCGTCAACCAACGAGACCATCACGTACGATAACGCTGGCAACGGATATCCCATGAGCGATGTCCTCCT
GTACCAGCAGTCTAAGTCCTGCATTGGAAATGTCGCGGATGGAAAGCTGCCGGTCACAGTCAAGGCTCTTATTCGCAAGGACCGTGTGCCCGCCACTGCTGATGGCCTGACTATGGATCT
GGTTCACGAGGTCCGCAGGCAGGGGGTGATTGTTCCTAGACTTGAAGTCGAAAAGATCAACTTCCAAGCCACTGGAGAGGATCAAGGCCAGTGGTCGATCTACACAGCCAGTGGAAGCGT
CGATGCCGATGGATGGAACACCAGCTTTGATATCAAGTTGGGTGGCGAAGACCCCACCGAGGTTGCGTTTCAAAAGACCGGAGCTCTAAGTTCCTGCAGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGCAGAGCATTCTCTCCACGCTCGCTCTGGCGTCCATCGCCGCGACGGAGTATGTTTGGCCTTCTCAGTACGATGAGCTCGAGGATCATCTCTCTCTCCAGTCCGGATACCTTCGA
AGAGGCTTCATCGATG
GCGTTATTACGTGCGGGTTCGGCACAAGCATTCCAGGCCGCCAGAACTCTGCTGAATGGATCCGCGCCGCTTTCCACGACATGGCTACGCATGATGCTGCCACT
GGCACTGGTGGCTTGGATGCGTCCATCTTCTTCGAGTTGGACCGCCCAGAGAATATCGGAGGCGCCTTCAACAACACCTTCGGATTCTTCAGCAGCTTCCACTCCATCCGCGCCTCTGCT
TCTGATTTGTTGGCCATGAGTGTCCTCGTCGCCAGCTTTGCTTGCGGCGGGATCCAAATCCCGTTCCGTGCCGGCCGTATTGACGCTCAAGAGGCCGGCCCTGCCGGTGTCCCGGAGCCT
CAGACCGATCTCAACACTACCCAGCAGGCTTTCACCAAGGCAGGCTTCTCTCAGAGCGACATGATTGCCATGGTTGCATGCGGTCATACTCTTGGAGGTGTACACAGCATGGACTTCCCC
GAGATCGTCGGCGTCGCGGCGGACCCCAATAACGACACCGTAGCGCACTTCGATACCGAATTTGCAAAGTTCGACAACGTCGTCGTGACTGAATATCTGGATGGCACAACCAAGAACCCT
CTGGTTGTTGGCACAAACGATACCCTCAACTCAGACAAGCGTATCTTCGCTGCAGATGGAAACAAGACGATGCAAGCCATGGCCGACCCTGACGCTTTCCAGGCTACCTGCGCCGATATC
TTCAGTCGTATGATTGATACTGTCCCCGCCAACGTTAAGCTCAGCGACCCCATCGTAGCCACAGACATTAAGCCCTACATCAGCGGGCTCTTCCTCAAGGACGACGGCAACCTGTCCTTC
GGCGGCCGCATTCGCATCCGCACCACCGCGGTCACTGGCCGGGATCCTAATGATCTCTCGGTTCAGCTGACGTACGCTGACCGCAACGGCAACGGATCAACCGTCATTACTACCCGTAAG
GCGACCTTCCAAGGTGGTAGCGCCTCTGGCTTATGGAGGGAGAGCTTCTACTGGTGGGAGTTCGACACCGTGATCAGCCCTGACACGGGCATCAGCAAGTTCTACATCCACGTTACGAAG
CCGTCAACCAACGAGACCATCACGTACGATAACGCTGGCAACGGATATCCCATGAGCGATGTCCTCCTGTACCAGCAGTCTAAGTCCTGCATTGGAAATGTCGCGGATGGAAAGCTGCCG
GTCACAGTCAAGGCTCTTATTCGCAAGGACCGTGTGCCCGCCACTGCTGATGGCCTGACTATGGATCTGGTTCACGAGGTCCGCAGGCAGGGGGTGATTGTTCCTAGACTTGAAGTCGAA
AAGATCAACTTCCAAGCCACTGGAGAGGATCAAGGCCAGTGGTCGATCTACACAGCCAGTGGAAGCGTCGATGCCGATGGATGGAACACCAGCTTTGATATCAAGTTGGGTGGCGAAGAC
CCCACCGAGGTTGCGTTTCAAAAGACCGGAGCTCTAAGTTCCTGCAGCTAG

Retrieve as FASTA