Entry information : CfioAPx-CcP02_PJ7
Entry ID 13165
Creation 2015-04-21 (Christophe Dunand)
Last sequence changes 2015-04-21 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-04-21 (Christophe Dunand)
Peroxidase information: CfioAPx-CcP02_PJ7
Name CfioAPx-CcP02_PJ7
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum fioriniae (Glomerella acutata)    [TaxId: 710243 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CfioAPx-CcP02_PJ7
start..stop
S start..stop
CfioAPx-CcP02_MH18 1058 0 17..538 1..522
BdotAPx-CcP01 596 0 7..537 6..538
BparvAPx-CcP 517 0 22..496 21..497
GgrAPx-CcP01 484 2e-167 3..538 8..546
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..145 145 N° 2 202..1676 1475  
join(1..145,202..1676)


exon

Literature and cross-references CfioAPx-CcP02_PJ7
Literature Baroncelli,R., Sreenivasaprasad,S., Sukno,S.A., Thon,M.R. and Holub,E. Draft Genome Sequence of Colletotrichum acutatum Sensu Lato (Colletotrichum fioriniae). Genome Announc 2 (2) (2014)
DNA ref. GenBank:   NW_006889217.1 (963..2638)
Cluster/Prediction ref. Genebank:   19043416
Protein sequence: CfioAPx-CcP02_PJ7
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   539 (518)
PWM (Da):   %s   58263.61 (55832.3)  
PI (pH):   %s   4.54 (4.50) Peptide Signal:   %s   cut: 22 range:22-539
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MWLARLLTILVWALFSMQSNGYVWPSRYDFLEDLLAIQSGATIFGFSSIVASCGNGQNNVGRQNSAEWIRAAFHDVVTYNKGAGTGGLDASLMYELDRDENHGRAFNRTFADMASFVNPRASAADLLALSVVAAAAGCGGQKIPFRAGRIDAIMAGPPGVPKPEQSLESHRTTFHRAGFNDSDMIALVACGHTLGRVHGDENQHVTGGEASDTNVVSFDNTPAAFDTAVVLGYLENDGVNPLVFNHNDTLNSDKRIFGVDGNVTMHAIADKETFQTTCAGVFEQMINTVPDHVTLSDPLELIDVKPYIDTLELSNDGTAIIFKGRIRVRTTNRDPEGFDIALDISQHNGQRKLIQTSRDRFQGGISIGFFGESFVWFRFDAQLDPTGGISGFNVQSMDLSTGQVETFDNSGTGGFPITDGLLYATDRSCLDITPRADGNMTLSVTAMVREDLLLVGGDVYLELTHRVHQQNIMLPRLQTESIPMTMGSAHIGGFVEFTETIPLAASGWNTVFDIVLVTEDGELRSDFHSSGTLASTSCF

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGCTGGCGCGACTTCTCACTATTCTAGTATGGGCATTATTCTCAATGCAATCAAATGGATATGTCTGGCCTTCGCGATATGACTTCCTGGAAGACCTTCTCGCAATTCAATCTGGG
GCCACTATTTTTGGCTTCAGCAGCA
GTACGAATCGACCCCATATTAAAATTTCGCTTGTTCTTTTTGCTGACGGATATTAGTTGTCGCCTCTTGTGGTAACGGGCAAAACAATGTCGGTC
GTCAGAACTCTGCTGAATGGATCCGAGCCGCGTTCCACGATGTTGTTACCTATAACAAGGGAGCCGGCACTGGTGGTCTCGATGCGTCTCTCATGTACGAGCTAGACCGTGACGAGAACC
ATGGAAGGGCCTTTAATCGCACGTTTGCCGACATGGCTAGCTTTGTCAACCCGAGGGCTAGCGCCGCCGATCTGCTCGCGCTTAGTGTGGTGGCCGCCGCAGCTGGGTGTGGTGGGCAGA
AAATCCCTTTCCGAGCCGGCCGCATTGACGCGATCATGGCTGGGCCTCCCGGCGTTCCGAAGCCCGAACAGTCTTTGGAAAGTCACAGAACGACGTTTCACCGAGCCGGATTCAACGACA
GCGATATGATAGCGCTCGTAGCCTGTGGTCACACACTCGGCCGAGTTCATGGAGACGAAAATCAACACGTGACGGGCGGCGAGGCGTCCGATACGAATGTGGTCAGCTTTGACAACACTC
CTGCCGCCTTCGACACCGCCGTGGTCCTTGGGTATCTCGAGAACGACGGCGTCAATCCCTTGGTGTTTAATCATAACGACACCCTGAACTCGGACAAGAGGATCTTCGGCGTTGACGGCA
ACGTCACTATGCATGCTATAGCAGACAAGGAAACGTTCCAAACCACCTGCGCAGGCGTATTCGAGCAAATGATCAACACGGTTCCTGATCACGTCACCCTGAGCGACCCGCTAGAGCTAA
TCGACGTCAAACCGTACATAGACACTTTAGAACTCAGCAATGATGGCACAGCGATCATCTTCAAAGGGCGAATCCGCGTGCGTACAACAAATCGCGACCCGGAGGGATTCGATATTGCTC
TTGACATCTCTCAACACAACGGACAACGAAAACTCATCCAAACCTCCAGAGATCGTTTCCAGGGTGGGATATCGATTGGTTTCTTTGGAGAGTCTTTCGTCTGGTTTCGATTTGATGCCC
AATTGGATCCAACTGGTGGAATTTCGGGCTTCAACGTACAGTCAATGGACCTCTCCACCGGCCAAGTCGAGACTTTTGACAATAGCGGGACAGGTGGCTTCCCGATCACTGATGGTTTGC
TTTATGCAACAGATCGATCTTGTTTGGATATCACGCCAAGAGCCGATGGTAATATGACGTTAAGTGTGACAGCTATGGTTCGAGAGGATCTGCTATTGGTTGGCGGCGATGTCTATCTCG
AGCTCACACACCGAGTTCATCAGCAGAACATAATGTTACCCAGGCTTCAAACCGAGAGCATACCGATGACTATGGGCAGCGCACATATTGGAGGTTTTGTGGAATTCACTGAAACGATCC
CTCTGGCGGCAAGCGGATGGAATACAGTCTTTGACATTGTGCTAGTGACGGAGGATGGGGAGCTGAGGTCTGACTTTCATAGCTCAGGCACATTGGCAAGTACATCGTGCTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGCTGGCGCGACTTCTCACTATTCTAGTATGGGCATTATTCTCAATGCAATCAAATGGATATGTCTGGCCTTCGCGATATGACTTCCTGGAAGACCTTCTCGCAATTCAATCTGGG
GCCACTATTTTTGGCTTCAGCAGCA
TTGTCGCCTCTTGTGGTAACGGGCAAAACAATGTCGGTCGTCAGAACTCTGCTGAATGGATCCGAGCCGCGTTCCACGATGTTGTTACCTATAAC
AAGGGAGCCGGCACTGGTGGTCTCGATGCGTCTCTCATGTACGAGCTAGACCGTGACGAGAACCATGGAAGGGCCTTTAATCGCACGTTTGCCGACATGGCTAGCTTTGTCAACCCGAGG
GCTAGCGCCGCCGATCTGCTCGCGCTTAGTGTGGTGGCCGCCGCAGCTGGGTGTGGTGGGCAGAAAATCCCTTTCCGAGCCGGCCGCATTGACGCGATCATGGCTGGGCCTCCCGGCGTT
CCGAAGCCCGAACAGTCTTTGGAAAGTCACAGAACGACGTTTCACCGAGCCGGATTCAACGACAGCGATATGATAGCGCTCGTAGCCTGTGGTCACACACTCGGCCGAGTTCATGGAGAC
GAAAATCAACACGTGACGGGCGGCGAGGCGTCCGATACGAATGTGGTCAGCTTTGACAACACTCCTGCCGCCTTCGACACCGCCGTGGTCCTTGGGTATCTCGAGAACGACGGCGTCAAT
CCCTTGGTGTTTAATCATAACGACACCCTGAACTCGGACAAGAGGATCTTCGGCGTTGACGGCAACGTCACTATGCATGCTATAGCAGACAAGGAAACGTTCCAAACCACCTGCGCAGGC
GTATTCGAGCAAATGATCAACACGGTTCCTGATCACGTCACCCTGAGCGACCCGCTAGAGCTAATCGACGTCAAACCGTACATAGACACTTTAGAACTCAGCAATGATGGCACAGCGATC
ATCTTCAAAGGGCGAATCCGCGTGCGTACAACAAATCGCGACCCGGAGGGATTCGATATTGCTCTTGACATCTCTCAACACAACGGACAACGAAAACTCATCCAAACCTCCAGAGATCGT
TTCCAGGGTGGGATATCGATTGGTTTCTTTGGAGAGTCTTTCGTCTGGTTTCGATTTGATGCCCAATTGGATCCAACTGGTGGAATTTCGGGCTTCAACGTACAGTCAATGGACCTCTCC
ACCGGCCAAGTCGAGACTTTTGACAATAGCGGGACAGGTGGCTTCCCGATCACTGATGGTTTGCTTTATGCAACAGATCGATCTTGTTTGGATATCACGCCAAGAGCCGATGGTAATATG
ACGTTAAGTGTGACAGCTATGGTTCGAGAGGATCTGCTATTGGTTGGCGGCGATGTCTATCTCGAGCTCACACACCGAGTTCATCAGCAGAACATAATGTTACCCAGGCTTCAAACCGAG
AGCATACCGATGACTATGGGCAGCGCACATATTGGAGGTTTTGTGGAATTCACTGAAACGATCCCTCTGGCGGCAAGCGGATGGAATACAGTCTTTGACATTGTGCTAGTGACGGAGGAT
GGGGAGCTGAGGTCTGACTTTCATAGCTCAGGCACATTGGCAAGTACATCGTGCTTTTGA

Retrieve as FASTA