Entry information : CfioAPx-CcP04_PJ7
Entry ID 13166
Creation 2015-04-21 (Christophe Dunand)
Last sequence changes 2015-04-21 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-04-21 (Christophe Dunand)
Peroxidase information: CfioAPx-CcP04_PJ7
Name CfioAPx-CcP04_PJ7
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum fioriniae (Glomerella acutata)    [TaxId: 710243 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CfioAPx-CcP04_PJ7
start..stop
S start..stop
CfioAPx-CcP04_MH18 2196 0 1..1097 1..1097
CgraAPx-CcP 1568 0 1..1097 1..1062
CgraAPx-CcP01 1123 0 15..735 15..747
CgraAPx-CcP01 175 1e-45 862..1062 544..747
CgraAPx-CcP01 143 2e-35 655..768 553..666
CgraAPx-CcP01 105 3e-23 1002..1095 575..666
CgloAPx-CcP02_Naragc5 1023 0 1..772 1..774
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..2185 2185 N° 2 2236..3344 1109  
join(1..2185,2236..3344)


exon

Literature and cross-references CfioAPx-CcP04_PJ7
DNA ref. GenBank:   NW_006889084.1 (97035..93692)
Cluster/Prediction ref. Genebank:   19036622
Protein sequence: CfioAPx-CcP04_PJ7
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1097 (1077)
PWM (Da):   %s   113524.17 (111485.0)  
PI (pH):   %s   4.9 (4.80) Peptide Signal:   %s   cut: 21 range:21-1097
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKVKSSILLSLLGLASQAQADLTWPSDIDELEEIMYQSFNFGSRHFADNVFPCAKEATGTGRQTAAEWLRTAFHDMAPANAGTGVGGLDASIQYELSSTGENTGPAFSSTLTFMGHYLTRKSSMSDLIALGVYTSVLSCGGPSVAIRSGRIDATVKGAAGVPQPNEVIQVFNSKFNRMGFTPQEMIQVTACGHTIGGVHTAENPTIVPDGTNTNGSAPMDSSNGVFDNRVVTEYLDGTTRNPLVIKMGTARASNSDFVVFSSDKNATVKAMTDLAVFKSTCKTVFEKMINTVPSGVTLGDAIAPYTVKPSQLQLSLTSSTIMTLTGYIRVRTTAITGISSLTINYKNRSGGSTCGTGSCVFTITISGISKGLEDSFSWYPIRQEIPVSTGISSFTVTINKSDGSSTLFNNNGNWYPIQDGIFLQTSQSCLTQISGDVTLVAAVRNDRTSLPVKAEISYKTARTSSVVPLLGKMTVDMVKGDCVGSYTFYSVTTNIPGGVSFESTFDFISGEGASAMIDPFKKADPIGGTCSSWTGGSPTCGSVTVSSSTSSAAATATISHRQTMGGYKLVSCWTEASGGRALSGAAFAYDGMTLDSCMANCTGFDYWGTEYGRECYCGNSLAASSSSAPLVDCSMQCSGDSTQYCGAGNRIELYSTTTTRTSSSTAAPTATLAHINTVGKYSLVGCQTEADGGRALSAAQTAADDMTLDKCASFCSDYTFFGTEYGRECYCGNSLAATSKTAPLSECNMKCAGNSYQYCGDGNRLELYKVGSASSTLASTVATTTSSSSSSTSSISVLAASGSSSSTLISASSTSSTSSTSSPVSTSSSSSVASSSSSTSSNSVASSTSVTSSSSTSSSVVSSSSSAVTSSTASPSASSTVSTSTTTSPTLAHRPTISPYTLVGCWTEGNGVRALSQKNYASGDNMTLEYCASYCSDYKYFGTEYSSECYCGNTLASTSAAAPLADCSMTCSGNKYEYCGGGNRLTLYQSDKQVTGPSQPATAGAYAFLGCRTEPAQGGRALDAKATASSDKMTNEACAAFCDGYSYFGTEYGGECYCGNSLPTTSLDAPLSDCSMLCTGSSTEYCGNGNRLSVYKK

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGTGAAATCATCAATACTGTTGAGCCTGCTCGGCTTAGCCTCACAGGCCCAGGCTGATCTGACATGGCCCTCGGACATTGACGAGTTGGAGGAGATCATGTACCAGTCGTTCAAT
TTCGGATCGCGACACTTTGCCGACAACGTCTTCCCCTGCGCCAAGGAGGCAACGGGCACCGGCCGCCAAACTGCTGCAGAATGGCTGCGAACCGCTTTTCACGATATGGCACCGGCCAAC
GCAGGGACAGGAGTTGGTGGGTTGGATGCATCTATACAATATGAGCTGTCGAGCACCGGCGAGAATACCGGCCCTGCCTTTTCGTCAACTCTGACCTTTATGGGACATTACTTGACCCGC
AAAAGCAGCATGTCGGATCTCATCGCTCTTGGAGTCTATACTTCGGTCCTGTCGTGCGGCGGTCCCTCAGTTGCAATCCGATCAGGCCGCATCGACGCAACCGTGAAAGGAGCCGCAGGC
GTACCGCAGCCCAACGAAGTCATCCAAGTTTTCAACTCGAAATTTAATCGCATGGGATTCACTCCACAAGAGATGATTCAAGTCACAGCTTGCGGCCATACAATTGGCGGCGTCCACACG
GCCGAGAATCCAACCATCGTTCCAGACGGCACAAATACCAACGGCTCCGCGCCCATGGATAGCTCAAACGGTGTCTTTGACAACAGAGTTGTGACCGAATATCTAGATGGCACCACGCGG
AACCCGCTTGTCATCAAAATGGGCACTGCTCGAGCCAGTAATTCCGATTTCGTCGTTTTCAGCTCCGACAAGAACGCCACCGTGAAGGCCATGACCGACCTCGCAGTCTTCAAGTCTACC
TGCAAGACCGTCTTCGAGAAGATGATCAACACCGTGCCATCTGGTGTTACTCTCGGCGATGCCATCGCACCCTACACCGTCAAGCCGTCCCAGCTTCAGCTCTCCCTCACTTCGTCCACC
ATCATGACTCTTACAGGTTACATTCGCGTCCGAACTACCGCCATCACAGGCATCTCGAGTCTGACGATCAACTATAAGAACCGGAGTGGCGGATCTACCTGCGGTACTGGCTCCTGTGTC
TTTACAATCACCATCTCGGGTATTTCCAAGGGCTTGGAAGACAGCTTCTCCTGGTATCCCATCAGGCAGGAGATTCCGGTCAGCACGGGCATCTCGTCCTTTACTGTGACGATCAACAAG
AGCGATGGCTCGAGCACATTATTTAACAACAATGGCAACTGGTACCCGATTCAGGATGGTATCTTTCTCCAGACGTCCCAGAGCTGCTTAACGCAGATCTCTGGCGATGTTACACTTGTC
GCCGCAGTCCGCAACGACCGCACGTCTCTCCCGGTCAAGGCAGAAATCTCTTACAAGACAGCGCGAACAAGCAGCGTGGTGCCCCTGCTAGGTAAGATGACCGTCGACATGGTCAAGGGT
GATTGTGTTGGCAGCTACACCTTTTACAGTGTCACCACGAATATTCCTGGTGGCGTCAGTTTCGAGTCGACTTTTGACTTCATCAGCGGAGAGGGCGCGTCCGCCATGATTGACCCGTTC
AAGAAGGCCGACCCTATCGGTGGGACATGTTCGAGCTGGACGGGAGGGTCTCCGACATGTGGCAGCGTCACAGTGTCGTCTTCTACGTCCAGCGCGGCTGCGACTGCTACGATTTCACAC
AGACAGACCATGGGCGGCTACAAGCTCGTCTCCTGCTGGACCGAGGCTTCTGGTGGCCGAGCTCTCAGCGGTGCCGCGTTCGCTTACGACGGCATGACCCTCGACAGCTGCATGGCAAAT
TGCACGGGGTTCGACTACTGGGGTACCGAATACGGACGCGAATGCTACTGCGGCAACTCTCTGGCTGCGTCTAGCAGTTCCGCACCGTTGGTCGATTGCAGCATGCAGTGCTCTGGTGAT
TCTACCCAGTACTGCGGAGCCGGCAATCGCATTGAGCTCTACTCGACCACCACCACCCGCACCAGCAGCTCCACGGCCGCTCCTACGGCTACTCTCGCACACATCAACACCGTCGGCAAG
TACTCACTCGTCGGCTGCCAGACGGAGGCCGATGGTGGTCGCGCACTTTCTGCTGCCCAGACTGCTGCGGATGACATGACTCTCGACAAGTGTGCTTCTTTCTGCTCCGACTATACATTC
TTCGGCACTGAGTATGGACGCGAAT
GTAAGTGTTGATTATATCTTGAGGTATGGATGAGAACTAACACAAAGTAGGCTATTGCGGTAACAGCCTGGCAGCAACCAGCAAGACTGCGCCTC
TGAGCGAGTGTAACATGAAGTGTGCTGGTAATTCGTACCAGTACTGCGGTGACGGCAACCGCCTGGAGCTGTACAAAGTCGGCAGTGCCTCGTCTACTTTGGCTTCGACGGTGGCTACTA
CGACCTCGAGCAGTTCTTCATCCACGAGCTCCATCAGTGTCTTAGCGGCGAGCGGATCATCGTCTTCTACTCTGATATCTGCATCCTCTACTTCCAGCACCTCTTCGACCTCGTCGCCGG
TGTCTACTTCAAGTTCGAGCAGTGTCGCATCTTCCAGCAGCTCTACTTCTTCTAACAGCGTAGCATCCTCAACCAGTGTCACGTCCTCCTCAAGCACCTCATCGAGCGTTGTCTCATCCT
CCAGCAGCGCCGTCACTTCATCGACAGCCTCGCCTTCGGCCTCAAGCACCGTCTCAACCTCAACAACCACATCTCCGACGCTAGCTCACAGGCCTACCATCTCGCCCTACACTCTGGTAG
GCTGCTGGACGGAAGGCAACGGTGTCCGCGCCCTGAGTCAGAAGAACTACGCCTCTGGCGACAACATGACGCTCGAGTACTGCGCCTCGTACTGCTCAGACTACAAGTACTTTGGCACTG
AATACAGCAGCGAATGCTACTGCGGCAACACCCTCGCCTCCACGAGCGCCGCCGCCCCCCTGGCAGACTGCAGCATGACCTGCAGCGGCAACAAGTACGAGTACTGCGGCGGCGGCAACC
GCCTGACCCTCTACCAGTCCGACAAGCAGGTAACGGGCCCCAGCCAGCCCGCCACAGCCGGAGCCTACGCTTTCCTCGGCTGCCGCACCGAACCCGCGCAGGGCGGACGCGCTCTGGATG
CCAAGGCTACGGCCAGCAGCGATAAGATGACCAACGAGGCGTGCGCGGCATTCTGCGATGGGTATAGCTACTTTGGAACGGAGTACGGCGGCGAGTGCTACTGTGGTAATTCCCTGCCGA
CGACGTCGCTTGATGCCCCGTTGAGCGATTGCAGTATGCTGTGTACGGGTTCCAGCACAGAATACTGCGGTAACGGCAATCGTTTGTCAGTGTATAAAAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGTGAAATCATCAATACTGTTGAGCCTGCTCGGCTTAGCCTCACAGGCCCAGGCTGATCTGACATGGCCCTCGGACATTGACGAGTTGGAGGAGATCATGTACCAGTCGTTCAAT
TTCGGATCGCGACACTTTGCCGACAACGTCTTCCCCTGCGCCAAGGAGGCAACGGGCACCGGCCGCCAAACTGCTGCAGAATGGCTGCGAACCGCTTTTCACGATATGGCACCGGCCAAC
GCAGGGACAGGAGTTGGTGGGTTGGATGCATCTATACAATATGAGCTGTCGAGCACCGGCGAGAATACCGGCCCTGCCTTTTCGTCAACTCTGACCTTTATGGGACATTACTTGACCCGC
AAAAGCAGCATGTCGGATCTCATCGCTCTTGGAGTCTATACTTCGGTCCTGTCGTGCGGCGGTCCCTCAGTTGCAATCCGATCAGGCCGCATCGACGCAACCGTGAAAGGAGCCGCAGGC
GTACCGCAGCCCAACGAAGTCATCCAAGTTTTCAACTCGAAATTTAATCGCATGGGATTCACTCCACAAGAGATGATTCAAGTCACAGCTTGCGGCCATACAATTGGCGGCGTCCACACG
GCCGAGAATCCAACCATCGTTCCAGACGGCACAAATACCAACGGCTCCGCGCCCATGGATAGCTCAAACGGTGTCTTTGACAACAGAGTTGTGACCGAATATCTAGATGGCACCACGCGG
AACCCGCTTGTCATCAAAATGGGCACTGCTCGAGCCAGTAATTCCGATTTCGTCGTTTTCAGCTCCGACAAGAACGCCACCGTGAAGGCCATGACCGACCTCGCAGTCTTCAAGTCTACC
TGCAAGACCGTCTTCGAGAAGATGATCAACACCGTGCCATCTGGTGTTACTCTCGGCGATGCCATCGCACCCTACACCGTCAAGCCGTCCCAGCTTCAGCTCTCCCTCACTTCGTCCACC
ATCATGACTCTTACAGGTTACATTCGCGTCCGAACTACCGCCATCACAGGCATCTCGAGTCTGACGATCAACTATAAGAACCGGAGTGGCGGATCTACCTGCGGTACTGGCTCCTGTGTC
TTTACAATCACCATCTCGGGTATTTCCAAGGGCTTGGAAGACAGCTTCTCCTGGTATCCCATCAGGCAGGAGATTCCGGTCAGCACGGGCATCTCGTCCTTTACTGTGACGATCAACAAG
AGCGATGGCTCGAGCACATTATTTAACAACAATGGCAACTGGTACCCGATTCAGGATGGTATCTTTCTCCAGACGTCCCAGAGCTGCTTAACGCAGATCTCTGGCGATGTTACACTTGTC
GCCGCAGTCCGCAACGACCGCACGTCTCTCCCGGTCAAGGCAGAAATCTCTTACAAGACAGCGCGAACAAGCAGCGTGGTGCCCCTGCTAGGTAAGATGACCGTCGACATGGTCAAGGGT
GATTGTGTTGGCAGCTACACCTTTTACAGTGTCACCACGAATATTCCTGGTGGCGTCAGTTTCGAGTCGACTTTTGACTTCATCAGCGGAGAGGGCGCGTCCGCCATGATTGACCCGTTC
AAGAAGGCCGACCCTATCGGTGGGACATGTTCGAGCTGGACGGGAGGGTCTCCGACATGTGGCAGCGTCACAGTGTCGTCTTCTACGTCCAGCGCGGCTGCGACTGCTACGATTTCACAC
AGACAGACCATGGGCGGCTACAAGCTCGTCTCCTGCTGGACCGAGGCTTCTGGTGGCCGAGCTCTCAGCGGTGCCGCGTTCGCTTACGACGGCATGACCCTCGACAGCTGCATGGCAAAT
TGCACGGGGTTCGACTACTGGGGTACCGAATACGGACGCGAATGCTACTGCGGCAACTCTCTGGCTGCGTCTAGCAGTTCCGCACCGTTGGTCGATTGCAGCATGCAGTGCTCTGGTGAT
TCTACCCAGTACTGCGGAGCCGGCAATCGCATTGAGCTCTACTCGACCACCACCACCCGCACCAGCAGCTCCACGGCCGCTCCTACGGCTACTCTCGCACACATCAACACCGTCGGCAAG
TACTCACTCGTCGGCTGCCAGACGGAGGCCGATGGTGGTCGCGCACTTTCTGCTGCCCAGACTGCTGCGGATGACATGACTCTCGACAAGTGTGCTTCTTTCTGCTCCGACTATACATTC
TTCGGCACTGAGTATGGACGCGAAT
GCTATTGCGGTAACAGCCTGGCAGCAACCAGCAAGACTGCGCCTCTGAGCGAGTGTAACATGAAGTGTGCTGGTAATTCGTACCAGTACTGCGGT
GACGGCAACCGCCTGGAGCTGTACAAAGTCGGCAGTGCCTCGTCTACTTTGGCTTCGACGGTGGCTACTACGACCTCGAGCAGTTCTTCATCCACGAGCTCCATCAGTGTCTTAGCGGCG
AGCGGATCATCGTCTTCTACTCTGATATCTGCATCCTCTACTTCCAGCACCTCTTCGACCTCGTCGCCGGTGTCTACTTCAAGTTCGAGCAGTGTCGCATCTTCCAGCAGCTCTACTTCT
TCTAACAGCGTAGCATCCTCAACCAGTGTCACGTCCTCCTCAAGCACCTCATCGAGCGTTGTCTCATCCTCCAGCAGCGCCGTCACTTCATCGACAGCCTCGCCTTCGGCCTCAAGCACC
GTCTCAACCTCAACAACCACATCTCCGACGCTAGCTCACAGGCCTACCATCTCGCCCTACACTCTGGTAGGCTGCTGGACGGAAGGCAACGGTGTCCGCGCCCTGAGTCAGAAGAACTAC
GCCTCTGGCGACAACATGACGCTCGAGTACTGCGCCTCGTACTGCTCAGACTACAAGTACTTTGGCACTGAATACAGCAGCGAATGCTACTGCGGCAACACCCTCGCCTCCACGAGCGCC
GCCGCCCCCCTGGCAGACTGCAGCATGACCTGCAGCGGCAACAAGTACGAGTACTGCGGCGGCGGCAACCGCCTGACCCTCTACCAGTCCGACAAGCAGGTAACGGGCCCCAGCCAGCCC
GCCACAGCCGGAGCCTACGCTTTCCTCGGCTGCCGCACCGAACCCGCGCAGGGCGGACGCGCTCTGGATGCCAAGGCTACGGCCAGCAGCGATAAGATGACCAACGAGGCGTGCGCGGCA
TTCTGCGATGGGTATAGCTACTTTGGAACGGAGTACGGCGGCGAGTGCTACTGTGGTAATTCCCTGCCGACGACGTCGCTTGATGCCCCGTTGAGCGATTGCAGTATGCTGTGTACGGGT
TCCAGCACAGAATACTGCGGTAACGGCAATCGTTTGTCAGTGTATAAAAAGTGA

Retrieve as FASTA