Entry information : CgloCIIAA02_Naragc5
Entry ID 13169
Creation 2015-04-21 (Christophe Dunand)
Last sequence changes 2015-04-21 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-04-22 (Christophe Dunand)
Peroxidase information: CgloCIIAA02_Naragc5
Name CgloCIIAA02_Naragc5
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum gloeosporioides (Glomerella cingulata)    [TaxId: 5457 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgloCIIAA02_Naragc5
start..stop
S start..stop
CgloCIIAA02_ST23 865 0 1..423 1..423
CfioCIIAA02_PJ7 699 0 1..423 1..422
CfioCIIAA02_MH18 699 0 1..423 1..422
CgraCIIAA02 696 0 1..423 1..421
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..1017 1017 N° 2 1073..1327 255  
join(1..1017,1073..1327)


exon

Literature and cross-references CgloCIIAA02_Naragc5
Literature Gan,P.H.P., Ikeda,K., Irieda,H., Narusaka,M., O'Connell,R.J., Narusaka,Y., Takano,Y., Kubo,Y. and Shirasu,K. Genome analysis of Colletotrichum orbiculare and Colletotrichum gloeosporioides
DNA ref. GenBank:   NW_006762378.1 (357441..356115)
Cluster/Prediction ref. Genebank:   18747594
Protein sequence: CgloCIIAA02_Naragc5
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   423 (406)
PWM (Da):   %s   45103.66 (43412.8)  
PI (pH):   %s   5.49 (5.27) Peptide Signal:   %s   cut: 18 range:18-423
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRVTLFTAALAATSVSAYPGMKNTFSEIRARVDADGGGADNDDFDSAELIGDLATLDDSKLTPVGKTVKSILLGNDINPESTDVYVTSGKANNLAAKGTPACAADTCCIWKYIANDLQGVFKGKSGRCTDFARAAVRLGFHDAGGWSKFTGDFGGADGSIILAAEEMSRGENNGLQEIVAQTQVWYNQYKQFGIGMADLIQFSASVATVVCPLGPRIRTYVGRKDSSKPCPNDLLPPVTGSADFLIELFENKTIKPHGLTALIGAHTTSQQRFVDPSRAGDPQDSTPGVWDVKFYAETLGSAPARVFKFASDVVLSKDSRISAEFQAFAGSGGQAHWNQDYAREYIRLSLLGVNNINDLTDCSKALPAKTGSFVAPDQAAMDKWLATKDRVAKIADELRNGGNISSLINNVLGWLKGIFGWKY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTGTGACTCTCTTTACCGCAGCCCTCGCGGCCACATCCGTCTCTGCCTACCCAGGCATGAAGAACACCTTCTCCGAAATCCGCGCCCGTGTTGATGCGGACGGCGGCGGCGCCGAC
AACGACGACTTTGACTCCGCCGAGCTGATCGGTGACCTCGCCACCCTCGACGACTCCAAGCTCACCCCCGTGGGCAAGACCGTCAAGTCTATCCTTCTTGGCAACGACATCAACCCCGAG
AGCACTGATGTCTATGTCACCTCTGGCAAGGCCAACAACCTCGCCGCCAAGGGCACGCCAGCCTGTGCCGCCGATACCTGCTGTATCTGGAAGTACATCGCCAACGATCTTCAGGGTGTC
TTCAAGGGCAAGTCCGGCCGTTGTACCGACTTTGCCCGTGCCGCCGTCCGTCTCGGCTTCCACGATGCCGGCGGCTGGTCCAAGTTCACCGGTGACTTTGGCGGCGCCGATGGTTCCATC
ATCCTGGCTGCCGAGGAGATGAGCCGTGGCGAGAACAACGGTCTTCAGGAGATCGTTGCCCAGACTCAAGTCTGGTACAACCAGTACAAGCAGTTCGGCATCGGTATGGCCGATCTTATC
CAGTTCTCTGCCAGCGTTGCCACCGTCGTCTGCCCTCTCGGCCCCCGCATCCGTACATATGTTGGCCGCAAGGACTCTTCTAAGCCATGCCCTAACGATCTTCTCCCTCCCGTCACCGGC
TCCGCCGACTTCCTGATTGAGCTGTTCGAGAACAAGACCATCAAGCCCCACGGCCTCACCGCTCTCATCGGCGCTCACACCACAAGCCAGCAGCGCTTCGTTGACCCCAGCCGCGCCGGT
GACCCACAGGACAGCACTCCCGGTGTCTGGGACGTCAAGTTCTACGCCGAGACCCTCGGCTCTGCCCCGGCCCGTGTCTTCAAGTTCGCTTCCGACGTCGTTCTGTCCAAGGACTCCCGT
ATCAGCGCTGAGTTCCAGGCCTTTGCTGGCTCTGGCGGCCAGGCTCACTGGAACCAG
GTAAGATACCCTTTCCCGATTGGAGATGCCACTCAGTCACTAACATGCTCTGAAGGACTATGC
CCGCGAGTACATTCGCCTGTCTCTCCTCGGTGTTAACAACATCAACGACCTCACTGATTGCTCCAAGGCCCTGCCTGCCAAGACCGGCAGCTTCGTTGCCCCTGATCAGGCTGCTATGGA
CAAGTGGCTGGCTACCAAGGACCGCGTTGCCAAGATTGCCGATGAGCTCCGCAACGGTGGCAACATCAGCAGTCTTATCAACAACGTTCTTGGCTGGCTTAAGGGTATCTTCGGCTGGAA
GTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTGTGACTCTCTTTACCGCAGCCCTCGCGGCCACATCCGTCTCTGCCTACCCAGGCATGAAGAACACCTTCTCCGAAATCCGCGCCCGTGTTGATGCGGACGGCGGCGGCGCCGAC
AACGACGACTTTGACTCCGCCGAGCTGATCGGTGACCTCGCCACCCTCGACGACTCCAAGCTCACCCCCGTGGGCAAGACCGTCAAGTCTATCCTTCTTGGCAACGACATCAACCCCGAG
AGCACTGATGTCTATGTCACCTCTGGCAAGGCCAACAACCTCGCCGCCAAGGGCACGCCAGCCTGTGCCGCCGATACCTGCTGTATCTGGAAGTACATCGCCAACGATCTTCAGGGTGTC
TTCAAGGGCAAGTCCGGCCGTTGTACCGACTTTGCCCGTGCCGCCGTCCGTCTCGGCTTCCACGATGCCGGCGGCTGGTCCAAGTTCACCGGTGACTTTGGCGGCGCCGATGGTTCCATC
ATCCTGGCTGCCGAGGAGATGAGCCGTGGCGAGAACAACGGTCTTCAGGAGATCGTTGCCCAGACTCAAGTCTGGTACAACCAGTACAAGCAGTTCGGCATCGGTATGGCCGATCTTATC
CAGTTCTCTGCCAGCGTTGCCACCGTCGTCTGCCCTCTCGGCCCCCGCATCCGTACATATGTTGGCCGCAAGGACTCTTCTAAGCCATGCCCTAACGATCTTCTCCCTCCCGTCACCGGC
TCCGCCGACTTCCTGATTGAGCTGTTCGAGAACAAGACCATCAAGCCCCACGGCCTCACCGCTCTCATCGGCGCTCACACCACAAGCCAGCAGCGCTTCGTTGACCCCAGCCGCGCCGGT
GACCCACAGGACAGCACTCCCGGTGTCTGGGACGTCAAGTTCTACGCCGAGACCCTCGGCTCTGCCCCGGCCCGTGTCTTCAAGTTCGCTTCCGACGTCGTTCTGTCCAAGGACTCCCGT
ATCAGCGCTGAGTTCCAGGCCTTTGCTGGCTCTGGCGGCCAGGCTCACTGGAACCAG
GACTATGCCCGCGAGTACATTCGCCTGTCTCTCCTCGGTGTTAACAACATCAACGACCTCACT
GATTGCTCCAAGGCCCTGCCTGCCAAGACCGGCAGCTTCGTTGCCCCTGATCAGGCTGCTATGGACAAGTGGCTGGCTACCAAGGACCGCGTTGCCAAGATTGCCGATGAGCTCCGCAAC
GGTGGCAACATCAGCAGTCTTATCAACAACGTTCTTGGCTGGCTTAAGGGTATCTTCGGCTGGAAGTACTAG

Retrieve as FASTA