Entry information : CgloCP02_Naragc5
Entry ID 13178
Creation 2015-04-23 (Christophe Dunand)
Last sequence changes 2015-04-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-04-23 (Christophe Dunand)
Peroxidase information: CgloCP02_Naragc5
Name CgloCP02_Naragc5
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum gloeosporioides (Glomerella cingulata)    [TaxId: 5457 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgloCP02_Naragc5
start..stop
S start..stop
CgloCP02_ST23 1551 0 1..757 1..757
CgraCP01 1339 0 1..757 1..758
CfioCP01_MH18 1323 0 1..757 1..757
CfioCP01_PJ7 1321 0 1..757 1..757
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..330 330 N° 2 402..2345 1944  
join(1..330,402..2345)


exon

Literature and cross-references CgloCP02_Naragc5
Literature Gan,P.H.P., Ikeda,K., Irieda,H., Narusaka,M., O'Connell,R.J., Narusaka,Y., Takano,Y., Kubo,Y. and Shirasu,K. Genome analysis of Colletotrichum orbiculare and Colletotrichum gloeosporioides
DNA ref. GenBank:   NW_006762096.1 (179801..177457)
Cluster/Prediction ref. Genebank:   18741761
Protein sequence: CgloCP02_Naragc5
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   757
PWM (Da):   %s   82646.43  
PI (pH):   %s   6.23
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAESKCPATRLMNTGGGGTKNRDWWPDALKLNILRQHTPVTNPLGQEFDYVAAFKTLDYEGVKKDLTALMTDSQDWWPADFGHYGGLFIRMAWHSAGTYRVQDGRGGGGEGQQRFAPLNSWPDNVSLDKARRLLWPIKQKYGNKISWADLMILAGNVALESMGFKTAGFSGGRPDTWEADESVYWGGENTWLGNDIRYAHGHEGKDGPGVVDGSQDTKSDIHTRELEAPLGAAHMGLIYVNPEGPDGNPDPVAAARDIRVTFGRMAMNDEETVALIAGGHSFGKTHGAAPDSNVAAEPEGAPIEQQGLGWVNKHGSGKGPDTITSGLEVTWTATPTKWSNKYLEYLFKFDWELTKSPAGANQWVAKNAEPIIPDAYDPNKKHLPTMLTTDLSMRFDPEYEKISRRFLENPDQFADAFAKAWFKLTHRDMGPRSRYVGPEVPTEEFIWQDPIPEVNHAVINDQDVGALKKEILATGVDGSKLISTAFASASTFRGSDKRGGANGARIRLAPQKDWKVNNPGQLKEVLSALEKVQQKFNSSASGGKKVSLADLIVLGGVAGVEQAAQNAGHNITVPFTPGRADASQEQTDVESVGHLEPIADGFRNYGKSTRRVKTENFLVDRANLLTLTAPELTALVGGLRVLNTNYDGSKHGVFTSRPGALTNDFFVNLLDMGTVWKATSDPDVFEGSDRKSGSKKWTASRVDLVFGSQAELRAVAEIYGQADGGQKFVQDFVKVWDKVMNLDRFDVKKGSNLPSRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGAGCAAGTGTCCAGCCACCCGCCTGATGAACACCGGCGGAGGTGGCACTAAGAACCGCGACTGGTGGCCCGACGCCTTGAAGCTCAACATCCTCCGCCAGCACACTCCCGTC
ACCAACCCATTGGGACAGGAGTTCGACTATGTTGCTGCGTTCAAGACCCTCGACTACGAGGGCGTGAAGAAGGACCTCACAGCTCTGATGACCGACTCTCAGGACTGGTGGCCAGCTGAC
TTCGGTCACTACGGAGGTCTTTTCATTCGTATGGCGTGGCACAGCGCAGGAACATACCGTGTCCAGGATGGTCGCGGAGGTGGCGGCGAG
GTAAGTCACACTCGGAGTTCGCTCCGAACC
CCCGCGTCAGATCAAGTTGCTAACCGAACTTCGTCGTACAGGGCCAGCAGCGATTTGCTCCTCTTAACAGCTGGCCAGACAATGTCAGTCTCGACAAGGCTCGCCGCCTATTGTGGCCTA
TCAAGCAAAAGTATGGCAACAAGATTTCATGGGCCGATCTCATGATCTTGGCCGGTAACGTTGCCCTCGAGTCTATGGGCTTCAAGACTGCCGGATTCTCCGGTGGTCGCCCTGACACCT
GGGAGGCCGATGAGTCTGTCTACTGGGGAGGTGAGAACACATGGCTGGGTAACGATATCCGCTATGCCCACGGCCACGAGGGCAAGGACGGCCCTGGTGTCGTCGACGGATCTCAGGACA
CTAAGTCGGACATCCACACCCGCGAGCTTGAGGCGCCCTTGGGAGCTGCCCACATGGGTCTTATCTACGTGAACCCTGAGGGTCCCGATGGCAACCCCGATCCCGTCGCTGCCGCGAGAG
ATATTCGTGTTACTTTCGGCCGTATGGCCATGAACGACGAGGAGACCGTCGCTCTCATTGCTGGTGGTCACTCTTTCGGCAAGACCCACGGTGCTGCTCCCGACAGCAACGTCGCGGCCG
AACCCGAAGGCGCTCCTATTGAGCAGCAAGGTCTCGGCTGGGTCAACAAGCACGGTTCCGGCAAGGGTCCTGATACCATTACCTCTGGTCTCGAGGTCACTTGGACCGCCACTCCCACCA
AGTGGAGCAACAAGTACCTCGAGTACCTATTCAAGTTCGACTGGGAGCTTACCAAGAGTCCCGCGGGCGCGAACCAGTGGGTGGCAAAGAACGCCGAGCCCATCATTCCCGATGCCTACG
ACCCCAACAAGAAGCACCTCCCCACCATGTTGACAACTGATTTGTCAATGCGCTTCGACCCCGAGTACGAGAAGATTTCTCGTCGCTTCCTCGAGAACCCAGACCAATTCGCTGATGCCT
TCGCCAAGGCCTGGTTCAAGCTCACCCACCGTGACATGGGTCCCCGTTCCCGCTATGTCGGCCCTGAGGTTCCCACCGAGGAGTTCATCTGGCAAGACCCCATCCCTGAGGTCAACCACG
CTGTCATCAACGACCAGGATGTCGGCGCCCTCAAGAAGGAGATTCTTGCCACTGGTGTTGACGGCTCTAAGCTCATTTCTACTGCCTTCGCTTCCGCATCCACTTTCCGCGGTAGTGATA
AGCGTGGTGGTGCCAACGGAGCCCGCATCCGCTTGGCTCCCCAGAAGGACTGGAAGGTCAACAACCCTGGCCAGCTTAAGGAGGTTCTCTCAGCCCTCGAGAAGGTCCAGCAAAAGTTCA
ACAGCTCCGCCTCTGGTGGCAAGAAGGTGTCTCTGGCCGACTTGATCGTCCTTGGTGGTGTTGCCGGTGTTGAGCAAGCCGCTCAAAACGCGGGACACAACATCACCGTTCCCTTCACCC
CTGGCCGTGCCGACGCGTCACAGGAGCAGACCGACGTTGAGTCTGTTGGCCACCTCGAGCCTATTGCCGATGGTTTCCGCAACTACGGCAAGTCAACACGCCGCGTCAAGACCGAGAACT
TCTTGGTTGACCGCGCCAATCTCCTTACCCTGACTGCCCCTGAGCTTACCGCTCTGGTCGGAGGTCTCCGTGTCTTGAACACCAACTATGACGGCTCCAAGCACGGTGTCTTCACCAGCC
GTCCTGGTGCTCTGACGAACGACTTCTTCGTCAACCTCCTGGATATGGGCACCGTCTGGAAGGCCACCAGCGACCCCGACGTCTTCGAGGGTAGCGACCGCAAGAGCGGCTCCAAGAAGT
GGACTGCCAGCCGCGTCGACTTGGTCTTCGGCTCTCAGGCTGAGCTCCGCGCCGTCGCTGAGATCTACGGCCAGGCCGATGGTGGCCAGAAGTTCGTGCAGGACTTCGTCAAGGTCTGGG
ACAAGGTCATGAACTTGGACCGATTCGACGTTAAGAAGGGTTCGAACCTCCCAAGCCGTCTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGAGCAAGTGTCCAGCCACCCGCCTGATGAACACCGGCGGAGGTGGCACTAAGAACCGCGACTGGTGGCCCGACGCCTTGAAGCTCAACATCCTCCGCCAGCACACTCCCGTC
ACCAACCCATTGGGACAGGAGTTCGACTATGTTGCTGCGTTCAAGACCCTCGACTACGAGGGCGTGAAGAAGGACCTCACAGCTCTGATGACCGACTCTCAGGACTGGTGGCCAGCTGAC
TTCGGTCACTACGGAGGTCTTTTCATTCGTATGGCGTGGCACAGCGCAGGAACATACCGTGTCCAGGATGGTCGCGGAGGTGGCGGCGAG
GGCCAGCAGCGATTTGCTCCTCTTAACAGC
TGGCCAGACAATGTCAGTCTCGACAAGGCTCGCCGCCTATTGTGGCCTATCAAGCAAAAGTATGGCAACAAGATTTCATGGGCCGATCTCATGATCTTGGCCGGTAACGTTGCCCTCGAG
TCTATGGGCTTCAAGACTGCCGGATTCTCCGGTGGTCGCCCTGACACCTGGGAGGCCGATGAGTCTGTCTACTGGGGAGGTGAGAACACATGGCTGGGTAACGATATCCGCTATGCCCAC
GGCCACGAGGGCAAGGACGGCCCTGGTGTCGTCGACGGATCTCAGGACACTAAGTCGGACATCCACACCCGCGAGCTTGAGGCGCCCTTGGGAGCTGCCCACATGGGTCTTATCTACGTG
AACCCTGAGGGTCCCGATGGCAACCCCGATCCCGTCGCTGCCGCGAGAGATATTCGTGTTACTTTCGGCCGTATGGCCATGAACGACGAGGAGACCGTCGCTCTCATTGCTGGTGGTCAC
TCTTTCGGCAAGACCCACGGTGCTGCTCCCGACAGCAACGTCGCGGCCGAACCCGAAGGCGCTCCTATTGAGCAGCAAGGTCTCGGCTGGGTCAACAAGCACGGTTCCGGCAAGGGTCCT
GATACCATTACCTCTGGTCTCGAGGTCACTTGGACCGCCACTCCCACCAAGTGGAGCAACAAGTACCTCGAGTACCTATTCAAGTTCGACTGGGAGCTTACCAAGAGTCCCGCGGGCGCG
AACCAGTGGGTGGCAAAGAACGCCGAGCCCATCATTCCCGATGCCTACGACCCCAACAAGAAGCACCTCCCCACCATGTTGACAACTGATTTGTCAATGCGCTTCGACCCCGAGTACGAG
AAGATTTCTCGTCGCTTCCTCGAGAACCCAGACCAATTCGCTGATGCCTTCGCCAAGGCCTGGTTCAAGCTCACCCACCGTGACATGGGTCCCCGTTCCCGCTATGTCGGCCCTGAGGTT
CCCACCGAGGAGTTCATCTGGCAAGACCCCATCCCTGAGGTCAACCACGCTGTCATCAACGACCAGGATGTCGGCGCCCTCAAGAAGGAGATTCTTGCCACTGGTGTTGACGGCTCTAAG
CTCATTTCTACTGCCTTCGCTTCCGCATCCACTTTCCGCGGTAGTGATAAGCGTGGTGGTGCCAACGGAGCCCGCATCCGCTTGGCTCCCCAGAAGGACTGGAAGGTCAACAACCCTGGC
CAGCTTAAGGAGGTTCTCTCAGCCCTCGAGAAGGTCCAGCAAAAGTTCAACAGCTCCGCCTCTGGTGGCAAGAAGGTGTCTCTGGCCGACTTGATCGTCCTTGGTGGTGTTGCCGGTGTT
GAGCAAGCCGCTCAAAACGCGGGACACAACATCACCGTTCCCTTCACCCCTGGCCGTGCCGACGCGTCACAGGAGCAGACCGACGTTGAGTCTGTTGGCCACCTCGAGCCTATTGCCGAT
GGTTTCCGCAACTACGGCAAGTCAACACGCCGCGTCAAGACCGAGAACTTCTTGGTTGACCGCGCCAATCTCCTTACCCTGACTGCCCCTGAGCTTACCGCTCTGGTCGGAGGTCTCCGT
GTCTTGAACACCAACTATGACGGCTCCAAGCACGGTGTCTTCACCAGCCGTCCTGGTGCTCTGACGAACGACTTCTTCGTCAACCTCCTGGATATGGGCACCGTCTGGAAGGCCACCAGC
GACCCCGACGTCTTCGAGGGTAGCGACCGCAAGAGCGGCTCCAAGAAGTGGACTGCCAGCCGCGTCGACTTGGTCTTCGGCTCTCAGGCTGAGCTCCGCGCCGTCGCTGAGATCTACGGC
CAGGCCGATGGTGGCCAGAAGTTCGTGCAGGACTTCGTCAAGGTCTGGGACAAGGTCATGAACTTGGACCGATTCGACGTTAAGAAGGGTTCGAACCTCCCAAGCCGTCTCTAG

Retrieve as FASTA