Entry information : CgloAPx-CcP03_Naragc5 (CgloHyBpox3)
Entry ID 13179
Creation 2015-04-23 (Christophe Dunand)
Last sequence changes 2015-04-23 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2016-12-12 (Marcel Zamocky)
Peroxidase information: CgloAPx-CcP03_Naragc5 (CgloHyBpox3)
Name (synonym) CgloAPx-CcP03_Naragc5 (CgloHyBpox3)
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum gloeosporioides (Glomerella cingulata)    [TaxId: 5457 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgloAPx-CcP03_Naragc5
start..stop
S start..stop
CgloAPx-CcP03_ST23 1106 0 1..539 1..539
CorbiAPx-CcP1 925 0 1..539 1..539
CfioAPx-CcP01_PJ7 919 0 1..539 1..536
CfioAPx-CcP01_MH18 914 0 1..539 1..536
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..136 136 N° 2 191..1674 1484  
join(1..136,191..1674)


exon

Literature and cross-references CgloAPx-CcP03_Naragc5 (CgloHyBpox3)
Literature Zamocky et al. (2017) in preparation
Protein ref. UniProtKB:   L2G1J1
DNA ref. GenBank:   NW_006762297.1 (66967..65294)
Cluster/Prediction ref. Broad:   18745857
Protein sequence: CgloAPx-CcP03_Naragc5 (CgloHyBpox3)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   539 (517)
PWM (Da):   %s   58167.51 (55793.3)  
PI (pH):   %s   4.48 (4.47) Peptide Signal:   %s   cut: 23 range:23-539
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKQSLLATVALATLASTEYVWPSIYDEIEDHLSLQSGYLRRGFIDGVLTCGFGTNIQGRQNSAEWIRSAFHDMATHDAEAGTGGLDASIFFELERAENIGKAFNNTFGFFSSFYSARASASDLLAMSVLVASYSCGGIKIPFRAGRVDAQEAGPAGVPEPQTDLEATQAAFTKAGFSTQDMIAMVACGHSLGGVHSTDFPEIVGVEADPNNDTVAHFDVKFDNFDNGVVTEYLDGSTKNPLVAGTNDTLNSDKRIFGADGNKTMQAMADPNTFQTMCADIFTRMIDTVPASVKLSDPIVATDIKPYINGLYLKDDGNISFAGRIRIRTSAETGRDPTDLSVQLTYADRNGNGSEVITTRKATFQGGSASGLWRESFAWWEFDTTISPETGISKFYIHVTKTSTNETITYDNAGNAYPMDDALLYQESQSCLDTNVVNGQMALTVKAFVRKDRLPAAASDLTLDLVNEFRRQGVIVPRLETEKIPFEAAGEEKEQWVAYKASGKVNADGWNTSFDIKLGGDKAVEVAFKKTGGLGSNVCS

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron), wsc domain-containing protein, Carbohydrate Binding Module
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCAGAGCCTCCTCGCCACCGTCGCTCTGGCGACACTCGCATCTACGGAGTACGTCTGGCCGTCGATTTACGATGAGATCGAGGACCACCTCTCCCTGCAGTCCGGATACCTGCGC
AGGGGCTTCATTGATG
GTTGGGCTTACTTCCTTGAATCAACGCAAACTCACATGTACTGACGTTGGCAAGGCGTTCTCACATGCGGTTTTGGTACAAACATCCAAGGCCGTCAAAACTCG
GCTGAATGGATTCGGAGCGCCTTCCACGATATGGCGACCCATGATGCTGAAGCTGGAACGGGAGGTCTTGACGCATCCATCTTCTTCGAGCTAGAGCGGGCGGAAAACATCGGAAAGGCT
TTCAACAATACGTTTGGCTTCTTCAGCAGCTTCTACTCTGCGCGCGCGTCAGCATCTGACTTATTGGCGATGAGTGTGCTTGTAGCCAGCTACTCCTGCGGCGGCATCAAGATCCCATTC
CGTGCCGGCCGTGTTGACGCCCAAGAAGCAGGACCGGCAGGTGTTCCAGAGCCGCAGACTGACTTGGAAGCCACTCAGGCGGCTTTCACCAAGGCTGGGTTCTCAACGCAGGACATGATT
GCCATGGTGGCCTGCGGTCATAGCCTCGGAGGAGTACACAGCACCGATTTTCCTGAGATCGTCGGCGTTGAAGCGGATCCCAACAACGACACCGTCGCTCATTTTGATGTCAAGTTTGAC
AACTTCGACAATGGCGTGGTCACGGAGTACCTGGATGGGTCGACGAAGAATCCTTTGGTTGCGGGAACCAACGACACCCTCAACTCCGACAAGCGCATCTTCGGCGCCGATGGTAACAAG
ACGATGCAAGCGATGGCCGACCCGAACACGTTCCAGACAATGTGTGCCGATATCTTCACTCGTATGATCGACACGGTCCCCGCGAGTGTCAAGCTCAGCGACCCTATTGTCGCGACGGAC
ATCAAACCCTACATTAACGGCTTGTATCTGAAGGACGACGGCAACATCTCGTTCGCTGGCCGCATCCGTATTCGCACTTCAGCCGAGACTGGACGAGACCCGACAGATCTTTCCGTGCAG
TTGACCTATGCCGACCGCAACGGTAATGGATCAGAGGTGATCACCACAAGAAAAGCGACCTTCCAAGGCGGATCTGCTTCCGGACTTTGGCGTGAGTCCTTTGCCTGGTGGGAGTTTGAC
ACCACTATTAGCCCTGAAACGGGTATCAGCAAGTTTTACATTCACGTAACAAAAACTTCCACGAACGAGACGATCACATACGACAATGCTGGAAATGCATACCCCATGGATGATGCCCTC
CTGTACCAGGAAAGCCAGTCTTGTCTCGATACCAATGTTGTAAACGGACAGATGGCTCTCACTGTCAAGGCCTTTGTGCGCAAGGACCGTCTACCCGCTGCAGCAAGCGACCTGACCCTG
GACCTCGTCAACGAATTCCGCCGACAAGGTGTTATCGTACCAAGACTGGAGACGGAGAAGATTCCTTTCGAGGCCGCAGGGGAGGAGAAGGAGCAGTGGGTCGCTTACAAGGCCTCTGGT
AAAGTCAATGCAGATGGCTGGAACACCAGCTTTGATATCAAGCTGGGTGGAGATAAGGCGGTCGAAGTCGCATTCAAGAAGACCGGTGGCTTGGGATCGAATGTCTGCTCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCAGAGCCTCCTCGCCACCGTCGCTCTGGCGACACTCGCATCTACGGAGTACGTCTGGCCGTCGATTTACGATGAGATCGAGGACCACCTCTCCCTGCAGTCCGGATACCTGCGC
AGGGGCTTCATTGATG
GCGTTCTCACATGCGGTTTTGGTACAAACATCCAAGGCCGTCAAAACTCGGCTGAATGGATTCGGAGCGCCTTCCACGATATGGCGACCCATGATGCTGAAGCT
GGAACGGGAGGTCTTGACGCATCCATCTTCTTCGAGCTAGAGCGGGCGGAAAACATCGGAAAGGCTTTCAACAATACGTTTGGCTTCTTCAGCAGCTTCTACTCTGCGCGCGCGTCAGCA
TCTGACTTATTGGCGATGAGTGTGCTTGTAGCCAGCTACTCCTGCGGCGGCATCAAGATCCCATTCCGTGCCGGCCGTGTTGACGCCCAAGAAGCAGGACCGGCAGGTGTTCCAGAGCCG
CAGACTGACTTGGAAGCCACTCAGGCGGCTTTCACCAAGGCTGGGTTCTCAACGCAGGACATGATTGCCATGGTGGCCTGCGGTCATAGCCTCGGAGGAGTACACAGCACCGATTTTCCT
GAGATCGTCGGCGTTGAAGCGGATCCCAACAACGACACCGTCGCTCATTTTGATGTCAAGTTTGACAACTTCGACAATGGCGTGGTCACGGAGTACCTGGATGGGTCGACGAAGAATCCT
TTGGTTGCGGGAACCAACGACACCCTCAACTCCGACAAGCGCATCTTCGGCGCCGATGGTAACAAGACGATGCAAGCGATGGCCGACCCGAACACGTTCCAGACAATGTGTGCCGATATC
TTCACTCGTATGATCGACACGGTCCCCGCGAGTGTCAAGCTCAGCGACCCTATTGTCGCGACGGACATCAAACCCTACATTAACGGCTTGTATCTGAAGGACGACGGCAACATCTCGTTC
GCTGGCCGCATCCGTATTCGCACTTCAGCCGAGACTGGACGAGACCCGACAGATCTTTCCGTGCAGTTGACCTATGCCGACCGCAACGGTAATGGATCAGAGGTGATCACCACAAGAAAA
GCGACCTTCCAAGGCGGATCTGCTTCCGGACTTTGGCGTGAGTCCTTTGCCTGGTGGGAGTTTGACACCACTATTAGCCCTGAAACGGGTATCAGCAAGTTTTACATTCACGTAACAAAA
ACTTCCACGAACGAGACGATCACATACGACAATGCTGGAAATGCATACCCCATGGATGATGCCCTCCTGTACCAGGAAAGCCAGTCTTGTCTCGATACCAATGTTGTAAACGGACAGATG
GCTCTCACTGTCAAGGCCTTTGTGCGCAAGGACCGTCTACCCGCTGCAGCAAGCGACCTGACCCTGGACCTCGTCAACGAATTCCGCCGACAAGGTGTTATCGTACCAAGACTGGAGACG
GAGAAGATTCCTTTCGAGGCCGCAGGGGAGGAGAAGGAGCAGTGGGTCGCTTACAAGGCCTCTGGTAAAGTCAATGCAGATGGCTGGAACACCAGCTTTGATATCAAGCTGGGTGGAGAT
AAGGCGGTCGAAGTCGCATTCAAGAAGACCGGTGGCTTGGGATCGAATGTCTGCTCTTAG

Retrieve as FASTA