Entry information : CgloAPx-CcP02_Naragc5
Entry ID 13180
Creation 2015-04-23 (Christophe Dunand)
Last sequence changes 2015-04-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-04-23 (Christophe Dunand)
Peroxidase information: CgloAPx-CcP02_Naragc5
Name CgloAPx-CcP02_Naragc5
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum gloeosporioides (Glomerella cingulata)    [TaxId: 5457 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgloAPx-CcP02_Naragc5
start..stop
S start..stop
CgloAPx-CcP02_ST23 2207 0 1..1106 1..1106
CgraAPx-CcP 1362 0 15..1106 15..1062
CfioAPx-CcP04_PJ7 1012 0 20..778 20..776
CfioAPx-CcP04_MH18 1009 0 20..778 20..776
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..2191 2191 N° 2 2242..3371 1130  
join(1..2191,2242..3371)


exon

Literature and cross-references CgloAPx-CcP02_Naragc5
Literature Gan,P.H.P., Ikeda,K., Irieda,H., Narusaka,M., O'Connell,R.J., Narusaka,Y., Takano,Y., Kubo,Y. and Shirasu,K. Genome analysis of Colletotrichum orbiculare and Colletotrichum gloeosporioides
DNA ref. GenBank:   NW_006762094.1 (66472..63102)
Cluster/Prediction ref. Genebank:   18741655
Protein sequence: CgloAPx-CcP02_Naragc5
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1106 (1086)
PWM (Da):   %s   114915.66 (112962.5)  
PI (pH):   %s   5.12 (4.98) Peptide Signal:   %s   cut: 21 range:21-1106
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKGATSLLLALLGLAARTTADPTWPADIDELEEIMYQTTGVRSRKFADSVNPCTREVSGAGRKNAAEWLRTAFHDMAPANVYRGTGGMDASLQYELGSSDNTGPGFGTTMTFMAPYLTRKSSMSDLIALGVYTSVLSCKGPSVAIRAGRIDATGPNDSGAVPTPGDSTPVFLNRFVRMGFSTADMIQMTACGHTIGGVHSADHPDIVPAGQFTNEVATFDTTDAAFDPKVITEYLAGTTQNPLVNVPGTQKGKNSDFRVFNADNNATVKAMTDATVFNNVCKAIFERMVNVVPSGVTLSDPIQPYQVKPVQMQLALADVSTLSLTGVIRVRTTNFPLSNIASLTISYKNRNGGTVCGSGACAFTITVSGASTNLEESFAWFTIMQNQQNGVRIPVSSGISSFTVTINMNDGSTKFFDNNGNGYPMQDGIFLQTDQSCLTQSNGNATFVAAVRNDRISQPVSVNVWYKTKRTTSVVPLLSNMTLAMTQGACQGGYTFFTVTTTIPGGVSVESTMDLISGDMVDSFKKANTVGGTCQGWSGGTSCSSITVSSVVPTSTASAPSHRATMGGYKFVSCWTEATNGRALKGAAFAYDGMTLSSCMANCTGFDYWGTEYGRECYCGNSLDSTSTSALLVDCNMPCSGDSTQYCGAGNRIELYSTTATRTSSSTASATATLAHISAVGQYSLVGCQTEATNGRALQATSTAADDMTLEKCATYCSGYTYFGTEYGRECYCGNSLQDSSKSAPITDCNMKCAGNQNQYCGDGNRLELYKLGTSSSSSHSSIASAATIASSSSSGTSSSSSSSITPSSTFSALGASGSSSSSSAPFTGSSTFSTVVSTSSAASSTRISTSSSSASTLSAQAVSSSASSSSSIPSSSLSSTRSPVSSTTTSSATSTVPTLAHKATVAAYNLTGCWTEGNGVRALSQNSYASHDNMTLENCAAFCSGYKYFGTEYGGECYCGNFLASSSSLAPLSDCSMTCTGNQYEYCGAGNRLTLYTNNNDKVTGPSQPATAGVYSFLGCRTEPAQGGRALSAKATASDKMTNEVCASFCDGFAYFGTEYSGECYCGSALPDTSIVAPVSECNMLCSGSSTEYCGSGNRLSVYKK

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). wsc domain containing protein
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGGGCGACATCCTTGCTGCTAGCCCTCCTGGGACTTGCAGCCAGAACCACCGCCGACCCAACATGGCCTGCAGACATCGACGAGCTCGAGGAGATCATGTACCAAACCACCGGT
GTTCGGTCACGAAAGTTTGCCGATTCCGTCAACCCCTGTACGCGAGAGGTCTCTGGTGCAGGTCGCAAAAACGCCGCCGAGTGGCTAAGGACCGCCTTTCACGACATGGCTCCTGCAAAC
GTATACAGGGGAACTGGCGGCATGGATGCATCTTTGCAGTATGAGCTGGGATCGAGCGACAACACAGGTCCAGGCTTCGGCACTACCATGACCTTCATGGCTCCCTATTTGACGCGCAAG
AGCAGTATGTCAGACCTCATCGCACTTGGCGTCTACACATCTGTGTTGTCTTGCAAGGGCCCATCTGTTGCCATAAGAGCCGGCCGGATCGATGCAACAGGACCGAACGACTCTGGCGCC
GTTCCCACACCTGGAGACTCGACTCCAGTGTTCCTGAACCGGTTTGTTCGCATGGGTTTCTCTACAGCAGATATGATACAAATGACGGCGTGCGGTCACACCATCGGCGGTGTTCACTCG
GCGGACCATCCCGATATCGTCCCTGCTGGCCAATTCACAAACGAAGTTGCCACCTTCGATACCACCGATGCCGCGTTCGATCCCAAAGTCATCACCGAATATCTCGCCGGTACCACTCAG
AACCCACTGGTCAACGTTCCCGGGACCCAGAAGGGAAAGAACTCCGACTTCAGAGTCTTTAACGCCGACAATAACGCAACCGTAAAGGCGATGACAGACGCCACCGTCTTCAACAACGTT
TGCAAAGCCATCTTTGAGAGAATGGTCAATGTCGTGCCGTCCGGCGTGACTCTGAGCGACCCCATCCAGCCCTACCAAGTTAAGCCGGTACAAATGCAGCTTGCACTCGCCGACGTATCA
ACCCTGTCACTGACGGGTGTTATCCGTGTCCGCACGACCAACTTCCCCCTTTCGAACATCGCCAGCCTCACTATCAGCTATAAGAATCGGAATGGCGGTACCGTGTGTGGATCTGGAGCT
TGTGCCTTCACCATTACCGTTTCTGGTGCTTCCACGAACTTGGAAGAGAGCTTCGCCTGGTTTACAATCATGCAGAATCAACAGAATGGAGTCAGAATCCCGGTCTCATCTGGTATCTCA
TCTTTCACGGTAACGATCAATATGAACGATGGTTCCACCAAATTCTTCGACAACAATGGCAACGGTTATCCCATGCAGGACGGCATTTTCCTTCAGACTGATCAGAGCTGTTTGACCCAG
TCCAACGGCAATGCCACTTTCGTTGCCGCCGTCCGTAACGATCGCATCTCACAGCCTGTGAGCGTCAACGTCTGGTACAAAACAAAGCGTACCACCAGTGTCGTGCCACTCCTGAGCAAC
ATGACATTGGCCATGACACAGGGAGCTTGTCAAGGAGGTTATACTTTCTTCACCGTGACGACCACCATACCGGGTGGTGTCAGTGTTGAGTCAACAATGGATTTAATCAGCGGAGACATG
GTCGATTCTTTCAAGAAGGCCAACACCGTAGGTGGAACCTGTCAGGGGTGGTCTGGAGGTACTTCTTGCAGCAGTATCACTGTCTCATCTGTTGTTCCGACAAGCACTGCAAGTGCCCCC
AGCCACCGTGCCACCATGGGCGGGTACAAGTTCGTTTCTTGCTGGACCGAAGCAACAAATGGGCGGGCTCTCAAGGGCGCGGCGTTCGCTTACGACGGCATGACTTTGAGTAGCTGCATG
GCCAACTGCACTGGATTCGACTACTGGGGAACGGAGTACGGACGGGAGTGCTACTGCGGTAACTCCTTGGACTCTACTAGTACTTCTGCACTCTTGGTCGACTGCAATATGCCCTGCTCT
GGAGACTCAACTCAGTACTGTGGCGCGGGCAACAGAATCGAGCTGTATTCGACCACCGCCACCCGTACAAGCAGCTCGACCGCGTCTGCGACTGCTACTCTCGCCCATATTTCCGCCGTT
GGACAGTACTCTTTGGTTGGTTGCCAGACCGAGGCCACCAATGGCCGCGCCCTCCAAGCAACTTCGACGGCAGCCGACGACATGACCCTGGAGAAGTGTGCTACCTACTGCTCTGGCTAC
ACATACTTTGGAACCGAGTACGGTCGCGAAT
GTAAGCAGCAGTCAACTCCCTTCCAGTTCATCTCGTCTAACAAGATACAGGCTATTGCGGTAACAGCCTGCAGGATTCTAGCAAGTCTG
CTCCTATTACCGATTGCAACATGAAATGTGCTGGGAACCAAAATCAGTATTGCGGTGACGGAAACCGTCTTGAGTTGTACAAGCTTGGAACCTCTTCGTCTTCCTCCCATTCTTCGATTG
CCTCGGCCGCGACAATCGCATCGAGCAGCAGTTCGGGTACTTCCAGCAGCTCCTCGAGCTCCATCACTCCCTCAAGCACCTTTAGTGCTCTCGGTGCCAGTGGATCTTCTTCCTCTTCCA
GTGCTCCGTTCACTGGGTCGTCCACCTTCAGCACCGTGGTCTCGACAAGTAGCGCCGCATCGTCGACTCGTATCTCCACTTCTTCCTCCTCCGCCTCAACCTTATCAGCCCAGGCCGTGT
CAAGCTCAGCCTCCAGCAGTTCATCGATTCCGAGCAGCAGTTTGTCTTCGACCAGGAGCCCTGTTTCTTCTACCACAACTTCAAGCGCGACTAGCACTGTCCCTACACTTGCCCACAAAG
CGACTGTGGCCGCTTACAACTTGACGGGCTGCTGGACAGAAGGAAATGGCGTTCGTGCGCTGAGCCAGAACAGCTATGCCTCCCACGACAACATGACTCTCGAAAACTGCGCCGCCTTCT
GTTCAGGTTACAAGTACTTCGGGACGGAGTATGGGGGCGAGTGTTATTGCGGCAACTTCCTCGCTTCGAGCAGCTCATTAGCTCCTTTGAGTGACTGCAGCATGACTTGCACCGGAAACC
AATACGAATACTGCGGCGCCGGCAACAGACTCACCCTTTACACCAACAACAACGACAAGGTTACTGGCCCAAGTCAACCTGCCACCGCCGGCGTCTACTCTTTCCTCGGCTGTCGGACTG
AGCCAGCCCAAGGTGGCCGTGCCCTGAGTGCGAAGGCGACGGCTTCAGACAAGATGACAAACGAGGTGTGCGCGTCGTTTTGTGACGGCTTCGCCTACTTTGGCACAGAATACAGCGGCG
AGTGCTATTGCGGCTCTGCCCTGCCCGACACATCCATTGTGGCACCTGTCAGCGAATGCAATATGCTTTGCTCGGGTAGCAGCACTGAGTACTGTGGCAGTGGCAATCGTTTGTCTGTGT
ACAAGAAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGGGCGACATCCTTGCTGCTAGCCCTCCTGGGACTTGCAGCCAGAACCACCGCCGACCCAACATGGCCTGCAGACATCGACGAGCTCGAGGAGATCATGTACCAAACCACCGGT
GTTCGGTCACGAAAGTTTGCCGATTCCGTCAACCCCTGTACGCGAGAGGTCTCTGGTGCAGGTCGCAAAAACGCCGCCGAGTGGCTAAGGACCGCCTTTCACGACATGGCTCCTGCAAAC
GTATACAGGGGAACTGGCGGCATGGATGCATCTTTGCAGTATGAGCTGGGATCGAGCGACAACACAGGTCCAGGCTTCGGCACTACCATGACCTTCATGGCTCCCTATTTGACGCGCAAG
AGCAGTATGTCAGACCTCATCGCACTTGGCGTCTACACATCTGTGTTGTCTTGCAAGGGCCCATCTGTTGCCATAAGAGCCGGCCGGATCGATGCAACAGGACCGAACGACTCTGGCGCC
GTTCCCACACCTGGAGACTCGACTCCAGTGTTCCTGAACCGGTTTGTTCGCATGGGTTTCTCTACAGCAGATATGATACAAATGACGGCGTGCGGTCACACCATCGGCGGTGTTCACTCG
GCGGACCATCCCGATATCGTCCCTGCTGGCCAATTCACAAACGAAGTTGCCACCTTCGATACCACCGATGCCGCGTTCGATCCCAAAGTCATCACCGAATATCTCGCCGGTACCACTCAG
AACCCACTGGTCAACGTTCCCGGGACCCAGAAGGGAAAGAACTCCGACTTCAGAGTCTTTAACGCCGACAATAACGCAACCGTAAAGGCGATGACAGACGCCACCGTCTTCAACAACGTT
TGCAAAGCCATCTTTGAGAGAATGGTCAATGTCGTGCCGTCCGGCGTGACTCTGAGCGACCCCATCCAGCCCTACCAAGTTAAGCCGGTACAAATGCAGCTTGCACTCGCCGACGTATCA
ACCCTGTCACTGACGGGTGTTATCCGTGTCCGCACGACCAACTTCCCCCTTTCGAACATCGCCAGCCTCACTATCAGCTATAAGAATCGGAATGGCGGTACCGTGTGTGGATCTGGAGCT
TGTGCCTTCACCATTACCGTTTCTGGTGCTTCCACGAACTTGGAAGAGAGCTTCGCCTGGTTTACAATCATGCAGAATCAACAGAATGGAGTCAGAATCCCGGTCTCATCTGGTATCTCA
TCTTTCACGGTAACGATCAATATGAACGATGGTTCCACCAAATTCTTCGACAACAATGGCAACGGTTATCCCATGCAGGACGGCATTTTCCTTCAGACTGATCAGAGCTGTTTGACCCAG
TCCAACGGCAATGCCACTTTCGTTGCCGCCGTCCGTAACGATCGCATCTCACAGCCTGTGAGCGTCAACGTCTGGTACAAAACAAAGCGTACCACCAGTGTCGTGCCACTCCTGAGCAAC
ATGACATTGGCCATGACACAGGGAGCTTGTCAAGGAGGTTATACTTTCTTCACCGTGACGACCACCATACCGGGTGGTGTCAGTGTTGAGTCAACAATGGATTTAATCAGCGGAGACATG
GTCGATTCTTTCAAGAAGGCCAACACCGTAGGTGGAACCTGTCAGGGGTGGTCTGGAGGTACTTCTTGCAGCAGTATCACTGTCTCATCTGTTGTTCCGACAAGCACTGCAAGTGCCCCC
AGCCACCGTGCCACCATGGGCGGGTACAAGTTCGTTTCTTGCTGGACCGAAGCAACAAATGGGCGGGCTCTCAAGGGCGCGGCGTTCGCTTACGACGGCATGACTTTGAGTAGCTGCATG
GCCAACTGCACTGGATTCGACTACTGGGGAACGGAGTACGGACGGGAGTGCTACTGCGGTAACTCCTTGGACTCTACTAGTACTTCTGCACTCTTGGTCGACTGCAATATGCCCTGCTCT
GGAGACTCAACTCAGTACTGTGGCGCGGGCAACAGAATCGAGCTGTATTCGACCACCGCCACCCGTACAAGCAGCTCGACCGCGTCTGCGACTGCTACTCTCGCCCATATTTCCGCCGTT
GGACAGTACTCTTTGGTTGGTTGCCAGACCGAGGCCACCAATGGCCGCGCCCTCCAAGCAACTTCGACGGCAGCCGACGACATGACCCTGGAGAAGTGTGCTACCTACTGCTCTGGCTAC
ACATACTTTGGAACCGAGTACGGTCGCGAAT
GCTATTGCGGTAACAGCCTGCAGGATTCTAGCAAGTCTGCTCCTATTACCGATTGCAACATGAAATGTGCTGGGAACCAAAATCAGTAT
TGCGGTGACGGAAACCGTCTTGAGTTGTACAAGCTTGGAACCTCTTCGTCTTCCTCCCATTCTTCGATTGCCTCGGCCGCGACAATCGCATCGAGCAGCAGTTCGGGTACTTCCAGCAGC
TCCTCGAGCTCCATCACTCCCTCAAGCACCTTTAGTGCTCTCGGTGCCAGTGGATCTTCTTCCTCTTCCAGTGCTCCGTTCACTGGGTCGTCCACCTTCAGCACCGTGGTCTCGACAAGT
AGCGCCGCATCGTCGACTCGTATCTCCACTTCTTCCTCCTCCGCCTCAACCTTATCAGCCCAGGCCGTGTCAAGCTCAGCCTCCAGCAGTTCATCGATTCCGAGCAGCAGTTTGTCTTCG
ACCAGGAGCCCTGTTTCTTCTACCACAACTTCAAGCGCGACTAGCACTGTCCCTACACTTGCCCACAAAGCGACTGTGGCCGCTTACAACTTGACGGGCTGCTGGACAGAAGGAAATGGC
GTTCGTGCGCTGAGCCAGAACAGCTATGCCTCCCACGACAACATGACTCTCGAAAACTGCGCCGCCTTCTGTTCAGGTTACAAGTACTTCGGGACGGAGTATGGGGGCGAGTGTTATTGC
GGCAACTTCCTCGCTTCGAGCAGCTCATTAGCTCCTTTGAGTGACTGCAGCATGACTTGCACCGGAAACCAATACGAATACTGCGGCGCCGGCAACAGACTCACCCTTTACACCAACAAC
AACGACAAGGTTACTGGCCCAAGTCAACCTGCCACCGCCGGCGTCTACTCTTTCCTCGGCTGTCGGACTGAGCCAGCCCAAGGTGGCCGTGCCCTGAGTGCGAAGGCGACGGCTTCAGAC
AAGATGACAAACGAGGTGTGCGCGTCGTTTTGTGACGGCTTCGCCTACTTTGGCACAGAATACAGCGGCGAGTGCTATTGCGGCTCTGCCCTGCCCGACACATCCATTGTGGCACCTGTC
AGCGAATGCAATATGCTTTGCTCGGGTAGCAGCACTGAGTACTGTGGCAGTGGCAATCGTTTGTCTGTGTACAAGAAATGA

Retrieve as FASTA