Entry information : SpolPrx03 ( Spipo8G0009800 [2.0])
Entry ID 13189
Creation 2015-05-28 (Christophe Dunand)
Last sequence changes 2016-02-25 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-25 (Christophe Dunand)
Peroxidase information: SpolPrx03 ( Spipo8G0009800 [2.0])
Name (synonym) SpolPrx03 ( Spipo8G0009800 [2.0])
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Araceae Spirodela
Organism Spirodela polyrhiza (great duckweed)    [TaxId: 29656 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SpolPrx03
start..stop
S start..stop
SpolPrx01 462 2e-165 19..330 18..329
RcPrx43 401 4e-141 14..330 16..330
PpePrx14 395 7e-139 21..330 24..328
AcPrx01 394 1e-138 14..330 10..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 959141..959353 213 N° 2 959489..959680 192 N° 3 959762..959927 166 N° 4 960058..960479 422
join(959141..959353,959489..959680,959762..959927,960058..960479)


exon

Literature and cross-references SpolPrx03 ( Spipo8G0009800 [2.0])
DNA ref. Phytozome 12:   pseudo8 (959141..960479)
Cluster/Prediction ref. Phytozome Gene 12:   31511542
Protein sequence: SpolPrx03 ( Spipo8G0009800 [2.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (306)
PWM (Da):   %s   35635.13 (33030.8) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.89 (7.36) Peptide Signal:   %s   cut: 25 range:25-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARQCCTIVFPAAFVLLLLGSANAQLGVGFYRESCPDAEAIVRAEISRVMRVAPTLGGPLLRLFFHDCFVRGCDASILLNATDSNNPAEKDAIPNSFLRGYGVIDTIKAKLEKACPSTVSCADVLALIARDVVSLAKGPYWEVPTGRRDGRVSIMSEALNMLPGFTANIANLKSQFAAQGLSVKDLVVLSGAHTLGNAHCFTVTNRIYNFSGRGDSADTDPALDRRYVPKLRGKCSPLPADALKLIEMDPGSFLSFDNSYFTLVSKRRGLFQSDAALLDDPETRAYVLRQAHAPPAEFFTDFGVSMVNMGNIGVLTGSQGEIRMHCALRN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from Phyrozome (extra large intron after GEIR).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAGGAAAGAG GATGATTTGA TTACACTCAA GTTAATATTT TCATATTCAA TAAATAACTA GTATAAAAGT TTTCTCATTT CTCTTTAGTG TACTACATAA TATACTTAAG TAAAGAATGA  CTATTGTGAA AAAAATAACT GTAGTAATTG AGGATTAATT TTTCCTATTG AACATCAGTC ATAAAAGTAA ATCTCTTTGT ATGAGCTTCT CACAGATTTT TCAAGATCTC TAATGACTAA  ATTTACTTCA AATATAATTT AATTCAAACT TTGTGTGAAT CTAATATGAC ATGTTCTTTT ACTATTTTGG ATATCTTCTA AGTAAATCAA CGTGTAAATA TTTTAATTTT TAATGTTTGT  ATCTAATAGG GACTGATTCA CATAAGGCTA TTGAAATTTG ATAAGCTTTA TAATGAACCT AATATGACAT GTCACACAAA AGTAATGATT TCTTATTCAT ATTACATCAG AATTTAGTCA  AATAAATATG AGATGTAAGT ATACTTAGTT AATAATAATT TTAATATTTC AAATAAAAAA TTCTATATCA AGAGTGATAT ATTTGATTTT CAATATATAT TCAATGATAT TCAGAAAATC  AAATTAGATG AAATCAACAG TTGACAGATC GTTTAACTGA TTCAATGTTA AAATTATTCG ATTGTAATGA AGTAAATTCA TGAAAATATA TGTGACTACG TAATATTTCA TAGAAACCCA  TGTTCCTCAT TGTAAGTCTC CACCCTATCT ACCGGTGGTC TCCCTCCTCT ACCAGGAAGC CCTCCCATTC TTTGGGTTTA GAGAGGGTGG GCCCAACTAC ACTTCTATAT TGGTTATCCC  TTGAGGGCGT TCCTCGGGCT TACCTCTGAT GGAGATTGAG CCTGCAGACA GTCTGGCTCA AGTTTGTTCT TGCTTGTGAA TGTCGTACAG TCTCAGACCA TTTACTATTG GAAACCATTC  TGGAGCATGT GATTGTGCTC CATTTCATAT TCAGCGTGCA TATTAAAAAC TGGTACCTTA CATTGTAAAA TTAGTTGGAA GAATTCCATG TGAAATGTCA AGGACATGTC ATTAAGTGAT  TGCGAGAGAG AGAGAGAGAG AGAGCCACAT TGCACGTAAA CTATATTCTG AAGTTCTATT CTGTACAATA TCAAAGCACG TACAGACTAT AAAACTTTTA AAAAAACATA GATAAATTAG  ATCTTTATCG TCACCGCATT CCTCGCTGAT GGAGAAAGGA CCCAGTGCAA GTTTGAACTG GTCAGTCGCG TAGGAATCTA GACCCTTCTG TCGAACCTCG GGCGCCGATA AGAAGCCGCT  TCTAACGCGC GTCTAGATTT ATATACGCCA TCGAAAATCT TGGGAGGGCG GCTCTCTATG TTGACTTGGA TTTTATACCA TGGATGATAA CTTGTGAGTA TCAAATGAAC ATTCGTTATC  CTCAGTCAAT AATCGAAGAT GGAACTTCAG ACTCTTTAAG TGCTAATCCA CCGAATTCCA TTGTCACTGG CAGATCATTA GAACTCGCCG GCAGCGGCAA GAGTCGTTGC CGTCTGGGAA  AGTTCAGCGC CTGAGGGCGG CCGTTGACTT GTCCTTCTCA GATAGTTGGC GTGGGGCGTT ACGTTGGGGG GGGGGGGGGG TGGGGTGGTG TGTGGGGAGG AAGCTTGAGG GATTTGGTGA  GCCAACACGA CGCAGCCTCT ATTGACAGCC GCCAGCGGAG GATCTCGTGA ATGAGTTGTT CTCCCCCTGA AATCCCACAT GCTCAACTTA TTGCCGGAAA TGCTTGTCCC ATAAGCTTAC  CGCTGCCATC TCCATCTCCA ACACGATACT CTACCAACTA CATCTCCTAT CGTACCAAAG AATCTTTGAA GCTTAACATT TATGATGTGC CTTCAGTTCT GAAGTTTCAG GACTACTATA  AAAGGAACTG GGGAGCAAGA CGAGGAGAGA CATTCCCATC CGCATTTCTC AGAGCCTACG TGTTGTTTAC CCAAATAGAC ATGGCTCGGC AATGTTGCAC CATCGTCTTC CCTGCCGCCT  TCGTCCTCCT CCTTCTGGGC TCCGCCAATG CCCAGTTGGG GGTAGGTTTC TACAGGGAAA GTTGCCCGGA CGCTGAGGCG ATTGTCCGGG CAGAGATCAG CCGGGTGATG AGGGTGGCTC  CGACTCTCGG CGGCCCCCTT CTGAGGCTCT TCTTCCATGA CTGCTTTGTC CGGGTACTCT ACTTGCGACT GCACTCACCT CAGAGATAGA TAATAAGCTT CCTTATGCCA TTAAATCATC  TGATTTAACT GCATATATGA TTTATAGCCC CGAATGTGGG ATTATTCCGA TGACCCTTCC GCATGCAGGG ATGTGATGCA TCGATCCTAT TGAATGCCAC CGACAGCAAC AACCCGGCGG  AGAAGGACGC CATCCCGAAC TCCTTCCTTC GAGGTTACGG GGTCATCGAC ACGATCAAGG CCAAACTCGA GAAGGCCTGC CCCTCGACAG TCTCCTGCGC CGACGTCCTG GCTCTTATCG  CCAGGGATGT CGTCTCTCTG GTCAGGTTGC TTATAATAGC CCCACGTACA GTATCATACG TAAATCACCC TTCGTCCCTA GCTGATTCTG AATGTTTGCA GGCCAAGGGC CCCTACTGGG  AAGTGCCCAC CGGTCGTCGC GATGGGCGGG TCTCCATCAT GAGCGAAGCA CTGAACATGC TCCCGGGATT CACGGCAAAC ATCGCCAACC TCAAGTCCCA GTTCGCCGCC CAGGGCCTGA  GCGTCAAGGA CCTCGTCGTC CTCTCAGGTC TGATATATGC ATATACGCAT ATATGTCTAT ATGTAATTTG TAGATATTTA CAGAGAAAGA GCTGGTGAGT GGGCGAAACA GATAGAGAAA  AGGAGGGATC TAACCGGAGG TGACTCTTTT GCATCAGGGG CTCACACTCT CGGGAACGCC CACTGCTTCA CGGTCACCAA CCGGATCTAC AACTTCTCCG GCAGGGGGGA CAGTGCCGAC  ACCGACCCGG CCCTTGACAG GAGGTACGTG CCGAAGCTGA GGGGCAAGTG CTCCCCGCTC CCGGCAGATG CTCTTAAGCT GATCGAAATG GACCCCGGCA GCTTTCTCTC CTTCGACAAC  AGCTACTTTA CCTTGGTCTC CAAAAGGCGG GGGCTCTTCC AGTCCGACGC CGCCCTGCTT GACGATCCAG AGACTAGGGC CTACGTTCTC CGCCAGGCCC ATGCACCACC GGCCGAGTTC  TTCACCGACT TCGGCGTTTC GATGGTCAAT ATGGGCAATA TTGGCGTCCT CACTGGGAGC CAGGGGGAAA TCCGGATGCA CTGTGCTCTC AGGAACTAGT GTTTTCACAA ATTTGCCAAA  TGAGAGGAAA TAAGATGCAA GGGATTCGTT TCCCTTCTAT CTCGCTTGTT CCTGTCCTTT TTATTCCCAA TTGTGCACAT CTCTATGTCA TGATAATCAT TAAGTTGAAT TTTAATTTGT  CTTATTTTTG CATTTATTTT CACTTTCGAT GTTTTCTGAA GAAACATATG AAAGTCGCTG AGTCGAGGAG TGGAGAATAA CCGTGCCAAT AATAATTTGC CGTCTAGGTT GGAGATTTAC  CAAAGTCCGC CTTGAAGTAT CGAAAATGCA AGGTAATGCC TCTTTGTAGT TGGGGTACTT GTTTCAGGGG AGTTCGAAAG TTGATCCGGA AGAGCCTTTT TGGGACTTGA ACGAAAAATA  AGAAATGGAT AACTTCCTTG GGCTAGTCAA AGTATGTCAG AATCAAATAT ATATAAACCG AATGTAGTAA GACCCTCCCT CTCTTCCCCG CCGGAGCCAA GTGAGCTACT CTGGCCCCAC  TAGCTATATA AAGGATGTTT CTGCCGAGGA TGCGAGAGGT AGCAAGAATG TTGCAGAATT TTGAATAACG ACCGGTTGAA GTGGACACAG ACATTGTCTT ACACGCATAG AATATATAAG  CTTCTTTTTT AAGATACAAA TCATGTCTGA TGCATTGCCT TTGATCTGTG ATTCCCGGAG AGTTTTGGAA TAATAAAAAA TTCATGTTAT TATGCAGATA TGTTACAAAT ATCGGGCTCA  TTCTATAGGC CCACGTATGT TGATGTAAAA GGAAAAACGG TGAACCGGAC AGGAATAACT TTTTCACTTC CCCATTTTTG TATTATGGTT TAAAAGCCCT AGTTTTTCCG GCACCATCGT  CACTGCTGCT GGTCGGGCAT CATTGCTGTC TGGATCTTCT AGCAGCTTCT GTAATTACAT TTGGAGCTTC CAGCAGCTTC TGTGATTGTG TTTGAGTTTT CGGCAGTCTC CATTGCTGCT  TCTACATTTC TAACATCACA TTGCTACGTT CGTAGCTTCC AGTAGATTCT GTGGCTGCAT CTGGGCCTTT TGGCAGCCTC TTTTCCTACG TCAACATGTT GGACAACCCA TTGCATCTGA  AACTTTCGGT AGCTCTCGTG GCTACGTTTG GCCCTCCAGT GGTGCCTATT TTTTGCCATC TGTGTTACAT CCTTCTCTTT TGCAGGATAT GGTGTCCTCA ACTAGCAGCG TACAAAATAC  CTCAATCTAT GTTCTTCACT TGCAAGATCC CAACAGTCCT TATATTCATC ATGGTGAGTC TCTATGACTC ATTTTGGCAC CCACCAAATT AACAAGTTCT GAAAACTATG CTTCTTGGAG  TTATGATATG TGTTAGTCTC TTTTTATCAA GAACTAACTA TGATTTATTG ATGGATCCTT TCTGAACCCT ACTACAATAG ACCAATGCCT CTCTTTTATT TGGTGAAGAA ACAATAATAT  GTTCAAAGCT TGGATCCGAA GCTCCACTTC TCCATCTATC TCAGTGAGTC TTCATCATAT AGAATTGGCA CCAACACTAT GGTCTAATCT CAGGACTCAC TTCAAAAGAA ATGATGACAC  TCATATATAT GTTCTTTGGC AACAACTATA CATTATTCAT CAAGAACAAG ACTAAACATA TACTTATTTT ACTTGTCTAA AAGCTATATG GGATGATATT CAAAATGCTG CCTCCCTAGT  AATTGTGGAG GTTGTTATTG TGGTGGTGCT CATCATGTGG TCAGTCGAGA TGAACATAAT TATCTTTTCT ACTTTCTTAT GAGATTAAAT GAAGATTATG GTTCTATTCA TTCACAAATT  CTTCTCATGA ATCTCCTTCC ACATCTCTTA AGAGCTTATA CAATTGTCTT CTAAGAAGAA AATTCTTGTA ATATTAGTCA GGTAGTTATG AGTTCACCTC CTTTAATCAC TAATGTTGCT  TTTGCTATCT CTTTTAACAA TCTTAAGCCA ACAATGATTG ATCTGAAGCA TCCAAAGGAT TGAGGTTCCT ACACTTATTG CAAGACATAT GGCCATATTA TCGAAAAATA TTATAAATGG  ATACCCTCCA AGCTACATAT TTCACCCAAA AGGTTATCAT CTTAATTAGG TTGTCAATCA TACTCCAAAT ATTGAAGGAT CATCTCATAT ATCAGCCCCA AATAATTTGA ATGACTTTAT  CTAAGACATC ACACCAAAAC AAGTTGCCCA CTCCATCGAG TGTTGATCCT TTATTTAGTA GATACAATAG TAGCTCCACT TGTTATTTTG GAGGTATTAT TTATTTATCT ATACTTTCCT  CATCTTCTTA TGTCAAATCT ACTATCTCTT GGTGGATTCT TGACTCTGGA TCCACAAGCA TATATGCTCA CAAGCAGCAT CTTTCATATC TATCCATTCT CTTCTCATTT CACTCATCAT  TTTATCGGAT GGGATAAGAG TATACAATAT CTCAAGGGGA GGGACATCAA GATTGAATTA GATTACTCAA AGATGTCTTA TTTGTGCCAT AAATTTAGTT TAATTTGATA TTTTTCAGTC  TTTTAACTGA TTTACAGCTT GATGTATTGG TTTCTTTCCC CCGCGCTCTT ATTCAAGAGA GATATTCCCA ACAAGTGATT GACAAGGCTA AGCGTAAAAA TGATCTATAT CGACTAGATC  CTAGTAAGAA TGTATCTTTT TTTCTTAACA TTTCAAGTTT GTATCTATTA ATTTTTGTGC ATACATCGCC CATCACATGG CACAATTAGT TGGGTCACAT ATCTAATCCT ATGATGCAAA  CACTCAATGA AAAGTTACAA TTGGCTGAAG TAGTTTCTAG GCCACCATGT CACATAGGTC ACCAAGCTAA ACAACGATGA TTGTCTTTCT CCTCTCATGG AAATAAAGCT GATCAACCTT  TTGATTTACT TCATTGTGAT ATTTGGGGAT CATATCATGT TGAGTCACAA TAGATTTAGA TATTTTCTCA CTATTGTGGA TGATCACGCA CATTTTATAT GGACCTTTTT AATGAAAGCT  AAATCTGACC CTTATTTAAT TATACCTCCT TTCGTCCATA TGGTTCACAC ACAATTTTGA TTGAAGATCA AACAATTTAG ATTACATAAT ACAAAGGAAC TTTAATTTTG AGATTTTTTT  ATTGAGCAAG GAATTTTACA TCAATATTCT TGTGTTGAAA CACCTCAATA AAATTTAGTG GTTGAATGCA AACACCAACA TTTACTTAAT GTGGCAATGA CATTCTTATT TTAGGCACGT  GTACCAGTGA AATCTTGATC TGAATACGTT TTCACTACAA CTTATCTCAT CAATTGCTTA CCATCTCCAT GTACTATCTT ACTCCATTTG AGTTGTTGTA TAAGAAGCTT GTTGATTAAT  CCCTTCTTTG AGTATTTAGA TGTTTGACTT TTGCATTCAC ATTACAGAAG AATTGTCTAA AATTTGCACC TCAAGCAACA TTAAGTGTAA TCATAGGATA TGCTCCAGGT ATAAAAGGTC  ATAAATTATG TCACATAGAA ACTACTAAGC TCTTCATTTC ACGGGATGTC ATTTTTTATG AACATATGTT TCCATTCAAG AAAGGTTAAG TAGAGTCACA TTTTTTAGAT AATATTGAGA  TTGTGCCTAC ACAAGACACA TTTGATCCTT TCTCTCTTGA TCAACAAGTT ACACCAAACC ATCATTTTGT AGATGGTCAC CTTGACGTTG AGTGTCATGA TCTAGCTGAT TCTTTAGAAG  ACATACATGC AAGTTACAAT GACTTCTATG ACACTACATC TCAAAATGTT GATAGTCAAG ATTAAGACCA CAATGTACTA CATGCCACCA CTTCATCACC AAGGAGATCT TGTCATGTCA  AGTGACCTCT TGCATATTTT TGATGGATTT TCATTTCAAC AATGTCATGG TGAAGAATCA AATATCATAT CTTTTCTTTG ATTATGTGGC TTATGGCTAT CACTCTCCTA TTTATCAACA  CTATCCTATG AGTATTTCTT CTATTCATGA ACCTGTATAT TATCATCAAG TGGTTCAATC TCCTCAATGG AGGAAAGTAA TGTAAGAGAA GCTAATATCA CTCAAGTCTA ATTCAACTTG  GTCCATTGTT TTCTTGCCCA TGGTAAATAG CCTATTGGAT GCAAGTGGGT ATACAAGATT AAGTAAAGAC CAAATGGCTC CATGGAGCAA TATAAAGCTC GATTAGTGGA TAAGGATTAT  ACACAATAAG AAGGCATTGA TTTGAGACCT TTTCTCAAGT GACGAAGTCT ACAACCATCT AACTTATTCT TACTATTGTA GTCATACAAA AATGACATAT TTTTTAGCTG GATATTAATA  CTGCATTCTA TAATGGAGAT TGTGGATGAA GTCTATATGA AGATTCCACT TGAATATTAA TATTTTAAAG AAATCCAACA CGTAAAAAGT TGGTATGTAA GCTTCACAAA TCAATATATG  GCCTATGTCA AACATCTCAT CAATGATGGT CCAAGTTATC TACCTCATTG ATTGAGTTTG GATTTTATCA ATCTAAATCA GATTACTCTC TTTTCATCAA GAAATCAAAT TCTAGTATAA  TTGTTATTTT GGTTTATGTT CCTGATATTA TTATTTTGGG ATCTAAACTT ATTTTAGATT CATTTGGCAA AGACATTCCT GAGTTCTAAA TTCAAACTCA AAAATCTTGG ACCTCTCAAA  TATTTTTTAG GATTATTGAT TGCTCGATCA ACAAAAAAAA TCATTTTAAC CCAAAGAAAT TATGCACTAC AAATTTTAGA TGATGTAGGT TTCTTAGTTG TAAAGCCAAG TGATATTCCT  ATGGATCGAA GATTGTGGTT AGCTACAGAC CAAGGAAATC CATTAGATGA TCCAACACAA TATAGAAGAT TACTTAAAAG ATTAATGTAT TTGACATTTT CAAGACTATA TATTACTTAT  GTGGTTCATA AGCTTAGCCA ATTTATGGAA AAATCATGTG ACACACATCT ACATGCCCTT CATCGTGTTT GTGTTATGTC AAATCTGCCC TTGGTCTAAG TTTATTTTTT TTGAGTACAT  CAGAGCTTCA ACTCTGAGCA TATTCTGATG CAAATTGGGC AGCTTGTCCA AACTCAAGAA GATCTATCAT TGGAATTTAC ATATTTTTGG GAGACTCCCT AATGTTTTGG AAATCAAAAA  AGTAACCAAT TATATCATGG TCATCAACAG AAATAGAATA TCGAGCACTA ATAGATAGTG CAACTGAGAT TTGTTAACTA CATCAACTAA TAGAAGACAT GTTTTTTAAA TAAGTGTCAA  ATCTTTTTTG TGACAATCAA GTAGCAAGAT AAATTGTTTC AAATTCAATA TTCTATGGGT AGACTAAATA CATTGAGATT GACTACCATT TCCTACATGA CAAAGTCTCT AAGGGAATTA  TTAAACTTCT CCCAATTAGC TCTAAACATC AATTGGTAGA TATTTTCACA GAAGCACTTC TATTGCCATC ATTTCAGGCC ATTCTCTCAA ACATGCAAAT GAAGAATATT TACCATTCCT  TAGATTGACC TTCCTTTTTT TCCTCTCAGA GTTGAAAGCA TGTCATGGGC AGATGACCAA TGTGAATCAA CAAACATATA GAATGAAATT TCTCTCATCT TACTGCACTC ATTCCTCTCC  ATTTTGTTAC AATTCATCGA CAAGGGGGTG TGTTAGAAAT ATTGGGCTCA TTCTATAGGC CCATATATGT CAATGTAAAG GGAGAAATGG TGAACCAGAC AGTGATAATT TTGTCACTTC  CTCTTTTTTT GTATTAAGAT AGGTTGTCTG TATCCAATCT GAAGGTTAAA TTTGTTCTTG GATTATTTTT ATGTGGTCAA AATCCATAGG TTTGGATTCT CACCTTTCAT GGTTTAAAGT  GGCTGAAACT TAAGTTTAAT GTGACACATT TAGCTGTCAC AAATACTCTC GCATTGAAGA GGAAAAAAAA CCTAGTTCTT CCATACCACC GTCGGATGCC TAACATGCTA ATGAACCAAC 
CTCTTAGTGC AGGGTGCACC GAACGAGTGG GTTTTTTTCA AATCACAGTT GATTTGTTCG TGGTTTGA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGGCAATGTTGCACCATCGTCTTCCCTGCCGCCTTCGTCCTCCTCCTTCTGGGCTCCGCCAATGCCCAGTTGGGGGTAGGTTTCTACAGGGAAAGTTGCCCGGACGCTGAGGCG
ATTGTCCGGGCAGAGATCAGCCGGGTGATGAGGGTGGCTCCGACTCTCGGCGGCCCCCTTCTGAGGCTCTTCTTCCATGACTGCTTTGTCCGG
GTACTCTACTTGCGACTGCACTCACCT
CAGAGATAGATAATAAGCTTCCTTATGCCATTAAATCATCTGATTTAACTGCATATATGATTTATAGCCCCGAATGTGGGATTATTCCGATGACCCTTCCGCATGCAGGGATGTGATGCA
TCGATCCTATTGAATGCCACCGACAGCAACAACCCGGCGGAGAAGGACGCCATCCCGAACTCCTTCCTTCGAGGTTACGGGGTCATCGACACGATCAAGGCCAAACTCGAGAAGGCCTGC
CCCTCGACAGTCTCCTGCGCCGACGTCCTGGCTCTTATCGCCAGGGATGTCGTCTCTCTG
GTCAGGTTGCTTATAATAGCCCCACGTACAGTATCATACGTAAATCACCCTTCGTCCCTA
GCTGATTCTGAATGTTTGCAGGCCAAGGGCCCCTACTGGGAAGTGCCCACCGGTCGTCGCGATGGGCGGGTCTCCATCATGAGCGAAGCACTGAACATGCTCCCGGGATTCACGGCAAAC
ATCGCCAACCTCAAGTCCCAGTTCGCCGCCCAGGGCCTGAGCGTCAAGGACCTCGTCGTCCTCTCAG
GTCTGATATATGCATATACGCATATATGTCTATATGTAATTTGTAGATATTTA
CAGAGAAAGAGCTGGTGAGTGGGCGAAACAGATAGAGAAAAGGAGGGATCTAACCGGAGGTGACTCTTTTGCATCAGGGGCTCACACTCTCGGGAACGCCCACTGCTTCACGGTCACCAA
CCGGATCTACAACTTCTCCGGCAGGGGGGACAGTGCCGACACCGACCCGGCCCTTGACAGGAGGTACGTGCCGAAGCTGAGGGGCAAGTGCTCCCCGCTCCCGGCAGATGCTCTTAAGCT
GATCGAAATGGACCCCGGCAGCTTTCTCTCCTTCGACAACAGCTACTTTACCTTGGTCTCCAAAAGGCGGGGGCTCTTCCAGTCCGACGCCGCCCTGCTTGACGATCCAGAGACTAGGGC
CTACGTTCTCCGCCAGGCCCATGCACCACCGGCCGAGTTCTTCACCGACTTCGGCGTTTCGATGGTCAATATGGGCAATATTGGCGTCCTCACTGGGAGCCAGGGGGAAATCCGGATGCA
CTGTGCTCTCAGGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGGCAATGTTGCACCATCGTCTTCCCTGCCGCCTTCGTCCTCCTCCTTCTGGGCTCCGCCAATGCCCAGTTGGGGGTAGGTTTCTACAGGGAAAGTTGCCCGGACGCTGAGGCG
ATTGTCCGGGCAGAGATCAGCCGGGTGATGAGGGTGGCTCCGACTCTCGGCGGCCCCCTTCTGAGGCTCTTCTTCCATGACTGCTTTGTCCGG
GGATGTGATGCATCGATCCTATTGAAT
GCCACCGACAGCAACAACCCGGCGGAGAAGGACGCCATCCCGAACTCCTTCCTTCGAGGTTACGGGGTCATCGACACGATCAAGGCCAAACTCGAGAAGGCCTGCCCCTCGACAGTCTCC
TGCGCCGACGTCCTGGCTCTTATCGCCAGGGATGTCGTCTCTCTG
GCCAAGGGCCCCTACTGGGAAGTGCCCACCGGTCGTCGCGATGGGCGGGTCTCCATCATGAGCGAAGCACTGAAC
ATGCTCCCGGGATTCACGGCAAACATCGCCAACCTCAAGTCCCAGTTCGCCGCCCAGGGCCTGAGCGTCAAGGACCTCGTCGTCCTCTCAG
GGGCTCACACTCTCGGGAACGCCCACTGC
TTCACGGTCACCAACCGGATCTACAACTTCTCCGGCAGGGGGGACAGTGCCGACACCGACCCGGCCCTTGACAGGAGGTACGTGCCGAAGCTGAGGGGCAAGTGCTCCCCGCTCCCGGCA
GATGCTCTTAAGCTGATCGAAATGGACCCCGGCAGCTTTCTCTCCTTCGACAACAGCTACTTTACCTTGGTCTCCAAAAGGCGGGGGCTCTTCCAGTCCGACGCCGCCCTGCTTGACGAT
CCAGAGACTAGGGCCTACGTTCTCCGCCAGGCCCATGCACCACCGGCCGAGTTCTTCACCGACTTCGGCGTTTCGATGGTCAATATGGGCAATATTGGCGTCCTCACTGGGAGCCAGGGG
GAAATCCGGATGCACTGTGCTCTCAGGAACTAG

Retrieve as FASTA