Entry information : SpolAPx03 (Spipo23G0031500)
Entry ID 13209
Creation 2015-06-09 (Christophe Dunand)
Last sequence changes 2015-06-09 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-02-26 (Catherine Mathe)
Peroxidase information: SpolAPx03 (Spipo23G0031500)
Name (synonym) SpolAPx03 (Spipo23G0031500)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Araceae Spirodela
Organism Spirodela polyrhiza (great duckweed)    [TaxId: 29656 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SpolAPx03
start..stop
S start..stop
GrAPx01 439 6e-159 1..250 1..250
ZmAPx02_B73 439 9e-159 1..250 1..250
SiAPx02 439 1e-158 1..250 1..250
SbAPx02 438 2e-158 1..250 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1912303..1912421 119 N° 2 1912542..1912716 175 N° 3 1912820..1912885 66 N° 4 1913660..1913708 49
N° 5 1913810..1913895 86 N° 6 1913998..1914077 80 N° 7 1914164..1914266 103 N° 8 1914380..1914438 59
N° 9 1914539..1914554 16  
join(1912303..1912421,1912542..1912716,1912820..1912885,1913660..1913708,1913810 ..1913895,1913998..1914077,1914164..1914266,1914380..1914438,1914539..1914554)


exon

Literature and cross-references SpolAPx03 (Spipo23G0031500)
DNA ref. Phytozome 12:   pseudo23 (1912303..1914554)
Cluster/Prediction ref. Phytozome Gene 12:   31516764
Protein sequence: SpolAPx03 (Spipo23G0031500)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   251
PWM (Da):   %s   27096.89  
PI (pH):   %s   5.02
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKSYPTPSEEYLKAVDKATRKIRGLIAEKKCAPLLLRLAWHSAGTFDVATKTGGPFGTIRDPAELAHLANTGLDIAVRLLAPIKEEVPILSYADFYQLAGVVAVEVSGGPDIPFHPGREDKTTPPPEGRLPDATQGTDHLRQVFGGQMGLSDQDIVALSGGHTLGRAHKERSGFEGPWTTNPNVFDNSYFKELLAGEKEGLLQLPTDKALLNDPVFRPLVDKYAADEDAFFVDYAEAHLKLSELGYADS*

Retrieve as FASTA  
Remarks
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGCAGT CAACGCAAAT CGTTGATCAG GCAAAGGGCT TCCGGCAGGG ACGCGGATGG GGTTAGGAAG GTCCCCGGAT GCATCTCCGG GTCAACCTTC TTCACTTGAA GCCGACGCGA  AAACCATAAC GCGGGCCTGG ACCTTGCTGA GGACGGAGCG CGTCCACCAC CAAATCGACC CCCTTCCATG GGAAAAAAAT ATTTGACTTG GTCTCGCCAG GGCACTCGGT CTACTACTCT  AATCGTGTTC CTCTCTCTCT CTCTnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nTCTCTCTCT CTCTCTCTCT CTCTCTCTCC  CTCTCTCTCT CTCCTCTCTC GGTTATCGAC TACGCGCAGG GGAGGGTTCC ATTGCAGTCG GTCAATTCCG AATGCCCGCG CGGCCATGGA TGTTTTTGAC CAGGAATGGT CAGCCGTCGG  CTCCTCCCGC CCACTACGGA GGACCGTACG TCACAGCTGG GGCCCATGAT GGGCTTTACC ATAAAAGAGA GGTCAACTCG CTTAAATCTT CTTCCGGATA GAATAGCGAG ATTAACCCAG  TCAGGGAGGG AGGCAGGGAA CGACGGGTCG GGCCACGTCA TCCCCAAAGA AAGTGGGAGT GAGGGAGAGA AGATAAAGCC CCGGGCTGAC TTTGAGGCCC ATTTCCAGAA ACAGCAAACT  GAACTGGTTA ATCATGTTGA CCGGTAGCAT TTAACCCATA ATAAGAAAGG TCATTATCGC ATGAACTGAG TCAAACTGGA CGGATGATGT CCTAATGCGG CCTAACAAAG ATTATGGTTT  GGGCCCACCT CCTATATGGG CTTTATTTTT TTTAAGGCCG GACCATGCGG TTCCCCAAAT GGATCCGAAT ATCCGGTTAT TTAATTAAAA ATAAATATTA CAAGTCCGCT GATGCCACGT  CTTATGTAGT GATCTACGTG GATCGCATCC ATCCATTTGA TTCTCTCCAC GTGGCGACGG ATCCTTCTCC CGCAGTGATT TTGTCCGTTC TATGCGTGAC TAATTGCAGG ATGTGATTGT  AGTAGTCATC TGACCAATCG TCATCCGCAC GTGTCAAGTG CAGATTGGAT CACCGAGAGA ATCATTTGCC CCAGTCCGCG TTCACACTGG CAAAGAATTT TGTATTTATC TATTTTTTAA  TTTTTAATCC CTTTATTTTT TTTACTTATG TATTTAGTCC TCAAACAGTT ATGGGCCCGG TGTTTTACAA GCGCAAATGG ATGATATAAA AGATGTTAAT TTAAATTTGA GGGCCAACGA  GAGTGTATCC TTTATGACAG GATGAAAATG AAATTCCGCC CTCTGAGGTT CATTCGATCA CGGATGTACC TTGCGAGTTG CGACGGGTTG GAAGTTGGCA GCCACACGCT CGGGGCTACC  CGTCACCGAG CTCTGAGAAA TCTTGACCGT CGGAATAACA TGGGCTGTAG ACCGTTGAGA TCAATCGATC GGACGGTGTT CAGCCCGTCA CCAGAAGCTT CCTCTCCAAG CTGTATAAAT  TGTGATGCGG CCTCCCCTAG CAGCAGTGTT CTTTGTGTTC GTCGTCTGTC AGATATCTTC AGTGAGTGCG GCTCTTCTTC TTCTTCTTCC TCTTCCGTTT TTTCCTTAGA TCGTTCTTCC  CGTAGATCGC CGTTCCGTCT GCCGATCTGG GGATCTCAGT GTATTCTGGT TTTGAAGGGA CTCCAGATCA AGTGGGGGAG ATGGGGAAGT CGTATCCGAC GCCGAGCGAG GAGTACCTGA  AGGCCGTCGA CAAGGCGACG AGGAAGATCC GTGGGCTCAT CGCCGAGAAG AAATGTGCTC CTCTGTTGCT ACGTCTCGCG TAAGACTGGC TACCTGACGA TCTCTCCGTT TCGTCGAACA  CCATTTCTGT CCAATCGATT TTGATCCTGA TCTACACATC TGGATATTCT TACTGCTGTT ACGATGCAAT GACCACCAGA TGGCACTCTG CGGGCACATT TGACGTGGCG ACGAAAACTG  GCGGGCCGTT CGGGACCATT AGGGACCCTG CCGAGCTCGC TCACTTGGCC AACACCGGCC TCGACATAGC GGTCCGTCTG TTGGCGCCGA TCAAGGAGGA GGTCCCTATC CTCTCCTACG  CCGACTTTTA TCAGGTCAGA TTTTTCGTAT ACATTTTTTT TTCCAATAGT TCTCTTGCTC TAGTATTTCT ATCCCCCACA GGAGGTCATT TTTTTGTTCA TTACTTTCCT CGAGCAGTTG  GCTGGGGTGG TCGCCGTAGA GGTCTCCGGA GGACCTGATA TCCCTTTCCA TCCCGGAAGG GAGGTAAGAG ATCTCTGATA TCCTTGTTCT CTGAGAACGT AGATAGTTTC GATCCAAAAA  CGTGCGATTG TTTTTTCCTT TCTGAAACCT GAAGATGCGT TGATCGTTTT TTGTTTTTCC TTCTCTCTCG AATTGTTCGT CTATTCGACA TCTATAAAAT ATTCTCAGCA TATCAATGCA  AGCCTGAAGG CTCTGTGTGT ACTGTGATTT TTAATACTGG ATACTCTTTT CTTATCGCTT GTCTGCCTCT TTTCAGCCTG TTCTGATCTT TTCGGCATGT AATGATCGGA AAAAGACGCA  CCACTAGTGC CTCATTTAAT CTGAATGAAT TCGTATACAC ATCTGCTCAT TTTCCCGATG TTTTTTTCTA ATTTGTGAAA ACTTACTGGA TAATTCCCAA GCAATGCGGT TCCGATCTAG  CTTGTCTCTC TTCCGAAAAA CAAAAACCGT TTTCTTCCGA CAAGCAAGGC AGCGCGTCAC TTGTTCTTCT TATGTGCAAT CCTTGCAGAG TGGGAGGCAA TTCTTCTATG ATTCAGTTCC  CTGTTTTCCT CTCTTGATGC TCTTTAAAAG TCGGAAGATC CTTTGTTCGC AAACCTTGCG AATTTTTCGG GGGCACTAGT AAATAGTAAT TGTTTAATAT CGTATTCCTC ACCCCCATGG  GTTATCTGAT TTGATGAATT TTTACATCTG CCCTCGTTTT GTTCAATATT CGATTGCCTC TTTGCATACG AACGCAGTCT TTAAATGTCC GCTGAAGTTA TTTCCTAACG TTTTCAGGAC  AAGACAACGC CCCCACCGGA GGGTCGTCTT CCAGACGCCA CTCAGGGTAA AGCGCTTCAG TTCCTCCAAC TCCCGATCGT TCCACTGGGT TTGGGTACCA GTGGCGCGGT GGATCCCAAC  TCACGTGATC TTCATATTTC CACGCAGGCA CCGACCACCT AAGGCAGGTG TTCGGTGGCC AGATGGGCCT CAGCGACCAG GACATCGTTG CTCTCTCTGG AGGCCACACC CTGGTTCGTA  TGACCGTCCT CACCCACCGC CACCATCCTC GTCAACCTTC CTGCCTTCCC CTGTTCCCGT CGACATAACG CGATTTTCTT TCTGCAACTT CGCAGGGTAG GGCTCACAAG GAACGTTCCG  GCTTCGAGGG CCCCTGGACC ACAAACCCTA ACGTCTTCGA CAACTCCTAC TTCAAGTGAG AACGAAGCCA TTCTCCTCTG TACTTCAAAC TTCATTCTTC TTTTCCAGAA TGTAATCGGT  GTTACTCTCT CTCTCTCTTA GGGAGCTCCT CGCGGGGGAG AAGGAAGGCC TTCTCCAGCT GCCAACAGAC AAAGCCCTTC TCAATGACCC CGTCTTCCGC CCCCTTGTGG ACAAATACGC  GGCTGTAAGC CCCCCCGCTC TCTACGACCG CCCTTCTCAC CCTCTATGAT TCCCGCCTGC TCACCCAACT CTCTCTCTCC CTCTCTCTCT CTCTCTTCTC CATTCCTGTG CCGACAGGAC  GAGGACGCCT TCTTCGTCGA CTATGCCGAA GCCCACCTGA AGCTCTCCGA ACTCGGGTAA GAACGAGTCA CCTCCTTTTC CTTCTCTTCT GCGTATGTAC GCCCGCTCTG AAGACGATCC 
CCTCACCCGT CCACTTGCGC TCGTGGTCGT CGCCAGTTAT GCCGACAGCT GA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGTCGTATCCGACGCCGAGCGAGGAGTACCTGAAGGCCGTCGACAAGGCGACGAGGAAGATCCGTGGGCTCATCGCCGAGAAGAAATGTGCTCCTCTGTTGCTACGTCTCGCG
TAAGACTGGCTACCTGACGATCTCTCCGTTTCGTCGAACACCATTTCTGTCCAATCGATTTTGATCCTGATCTACACATCTGGATATTCTTACTGCTGTTACGATGCAATGACCACCAGA
TGGCACTCTGCGGGCACATTTGACGTGGCGACGAAAACTGGCGGGCCGTTCGGGACCATTAGGGACCCTGCCGAGCTCGCTCACTTGGCCAACACCGGCCTCGACATAGCGGTCCGTCTG
TTGGCGCCGATCAAGGAGGAGGTCCCTATCCTCTCCTACGCCGACTTTTATCAG
GTCAGATTTTTCGTATACATTTTTTTTTCCAATAGTTCTCTTGCTCTAGTATTTCTATCCCCCACA
GGAGGTCATTTTTTTGTTCATTACTTTCCTCGAGCAGTTGGCTGGGGTGGTCGCCGTAGAGGTCTCCGGAGGACCTGATATCCCTTTCCATCCCGGAAGGGAGGTAAGAGATCTCTGATA
TCCTTGTTCTCTGAGAACGTAGATAGTTTCGATCCAAAAACGTGCGATTGTTTTTTCCTTTCTGAAACCTGAAGATGCGTTGATCGTTTTTTGTTTTTCCTTCTCTCTCGAATTGTTCGT
CTATTCGACATCTATAAAATATTCTCAGCATATCAATGCAAGCCTGAAGGCTCTGTGTGTACTGTGATTTTTAATACTGGATACTCTTTTCTTATCGCTTGTCTGCCTCTTTTCAGCCTG
TTCTGATCTTTTCGGCATGTAATGATCGGAAAAAGACGCACCACTAGTGCCTCATTTAATCTGAATGAATTCGTATACACATCTGCTCATTTTCCCGATGTTTTTTTCTAATTTGTGAAA
ACTTACTGGATAATTCCCAAGCAATGCGGTTCCGATCTAGCTTGTCTCTCTTCCGAAAAACAAAAACCGTTTTCTTCCGACAAGCAAGGCAGCGCGTCACTTGTTCTTCTTATGTGCAAT
CCTTGCAGAGTGGGAGGCAATTCTTCTATGATTCAGTTCCCTGTTTTCCTCTCTTGATGCTCTTTAAAAGTCGGAAGATCCTTTGTTCGCAAACCTTGCGAATTTTTCGGGGGCACTAGT
AAATAGTAATTGTTTAATATCGTATTCCTCACCCCCATGGGTTATCTGATTTGATGAATTTTTACATCTGCCCTCGTTTTGTTCAATATTCGATTGCCTCTTTGCATACGAACGCAGTCT
TTAAATGTCCGCTGAAGTTATTTCCTAACGTTTTCAGGACAAGACAACGCCCCCACCGGAGGGTCGTCTTCCAGACGCCACTCAGGGTAAAGCGCTTCAGTTCCTCCAACTCCCGATCGT
TCCACTGGGTTTGGGTACCAGTGGCGCGGTGGATCCCAACTCACGTGATCTTCATATTTCCACGCAGGCACCGACCACCTAAGGCAGGTGTTCGGTGGCCAGATGGGCCTCAGCGACCAG
GACATCGTTGCTCTCTCTGGAGGCCACACCCTG
GTTCGTATGACCGTCCTCACCCACCGCCACCATCCTCGTCAACCTTCCTGCCTTCCCCTGTTCCCGTCGACATAACGCGATTTTCTT
TCTGCAACTTCGCAGGGTAGGGCTCACAAGGAACGTTCCGGCTTCGAGGGCCCCTGGACCACAAACCCTAACGTCTTCGACAACTCCTACTTCAAGTGAGAACGAAGCCATTCTCCTCTG
TACTTCAAACTTCATTCTTCTTTTCCAGAATGTAATCGGTGTTACTCTCTCTCTCTCTTAGGGAGCTCCTCGCGGGGGAGAAGGAAGGCCTTCTCCAGCTGCCAACAGACAAAGCCCTTC
TCAATGACCCCGTCTTCCGCCCCCTTGTGGACAAATACGCGGCT
GTAAGCCCCCCCGCTCTCTACGACCGCCCTTCTCACCCTCTATGATTCCCGCCTGCTCACCCAACTCTCTCTCTCC
CTCTCTCTCTCTCTCTTCTCCATTCCTGTGCCGACAGGACGAGGACGCCTTCTTCGTCGACTATGCCGAAGCCCACCTGAAGCTCTCCGAACTCGGGTAAGAACGAGTCACCTCCTTTTC
CTTCTCTTCTGCGTATGTACGCCCGCTCTGAAGACGATCCCCTCACCCGTCCACTTGCGCTCGTGGTCGTCGCCAGTTATGCCGACAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGTCGTATCCGACGCCGAGCGAGGAGTACCTGAAGGCCGTCGACAAGGCGACGAGGAAGATCCGTGGGCTCATCGCCGAGAAGAAATGTGCTCCTCTGTTGCTACGTCTCGCA
TGGCACTCTGCGGGCACATTTGACGTGGCGACGAAAACTGGCGGGCCGTTCGGGACCATTAGGGACCCTGCCGAGCTCGCTCACTTGGCCAACACCGGCCTCGACATAGCGGTCCGTCTG
TTGGCGCCGATCAAGGAGGAGGTCCCTATCCTCTCCTACGCCGACTTTTATCAG
TTGGCTGGGGTGGTCGCCGTAGAGGTCTCCGGAGGACCTGATATCCCTTTCCATCCCGGAAGGGAG
GACAAGACAACGCCCCCACCGGAGGGTCGTCTTCCAGACGCCACTCAGGGCACCGACCACCTAAGGCAGGTGTTCGGTGGCCAGATGGGCCTCAGCGACCAGGACATCGTTGCTCTCTCT
GGAGGCCACACCCTG
GGTAGGGCTCACAAGGAACGTTCCGGCTTCGAGGGCCCCTGGACCACAAACCCTAACGTCTTCGACAACTCCTACTTCAAGGAGCTCCTCGCGGGGGAGAAGGAA
GGCCTTCTCCAGCTGCCAACAGACAAAGCCCTTCTCAATGACCCCGTCTTCCGCCCCCTTGTGGACAAATACGCGGCT
GACGAGGACGCCTTCTTCGTCGACTATGCCGAAGCCCACCTG
AAGCTCTCCGAACTCGG
TTATGCCGACAGCTGA

Retrieve as FASTA