Entry information : SpolPrx14 ( Spipo12G0056700)
Entry ID 13214
Creation 2015-06-09 (Christophe Dunand)
Last sequence changes 2015-06-09 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-02-26 (Catherine Mathe)
Peroxidase information: SpolPrx14 ( Spipo12G0056700)
Name (synonym) SpolPrx14 ( Spipo12G0056700)
Class Class III peroxidase    [Orthogroup: Prx020]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Araceae Spirodela
Organism Spirodela polyrhiza (great duckweed)    [TaxId: 29656 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SpolPrx14
start..stop
S start..stop
VvPrx18 455 1e-162 21..326 21..326
AfpPrx18 447 1e-159 1..326 1..324
AcoPrx36 447 1e-159 1..326 1..324
RcPrx06 447 2e-159 1..326 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3998474..3998683 210 N° 2 3998188..3998385 198 N° 3 3997959..3998124 166 N° 4 3997482..3997891 410
complement(join(3997482..3997891,3997959..3998124,3998188..3998385,3998474..3998 683))


exon

Literature and cross-references SpolPrx14 ( Spipo12G0056700)
DNA ref. Phytozome 12:   pseudo12 (3997482..3998683)
Cluster/Prediction ref. Phytozome Gene 12:   31503005
Protein sequence: SpolPrx14 ( Spipo12G0056700)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (304)
PWM (Da):   %s   35318.92 (32844.6) Transmb domain:   %s   i7-25o
PI (pH):   %s   8.74 (8.74) Peptide Signal:   %s   cut: 24 range:24-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MESTRSLLLLGAFLMALLVVASAQLRQNYYSNVCPGVEDIVRGAVERKLQQTFIAAPGTLRLFFHDCFVRGCDASVMISDPKGNDEKDSSDGISLAGDGFDTVVKAKAAVDAVVGCTNQVSCADILAMAARDVVSLTGGPFFPVELGRRDGRTSTKAGVRHKLPLPRFTLDQLNAMFASRGLSQTDMIALSGAHTIGFSHCSRFSSRIYRYSKTRAVDPSMNKAYVLKLRKDCPAGVDPGVVVNLDPSTPQAFDNAYFQNLQKGMGLLASDQVLFTDTRSRETVNLFAANRTAFEEAFAAAMIKLGRVDLKTGSRGEVRRDCSSVNS*

Retrieve as FASTA  
Remarks
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTGTGAAGAA TGCAAGAAAG CCTAGGCAGA AAGCATATGA GACCATTTCC GAGAGGGTGC CATGATAATC AGAAGTACCA TCAAAAGTTA TAAAAAAATC AAAGCTCATG ACTAACTAGA  AAGCAATAAG AAAACAAATG AGAAGAGAAT ACAGCAGGCA CAGCAACGCA AACTGATTTA AAATGACTAT CAGCTGGTAC TTCAGAATGC ATTACTACCA GGCTCGAAAT AGAACATAAA  CGAGAGTGTA AGAACTAGAA AAATGAGATT TCCAATATCA ATTAAAATTA CTCGGCTGAA GAAAACAGGG GATGGAGACA CATTTATAGC CAAATAGCAA TCTATCACAT ACTAATGAGA  CTAACAGGAT AACGCAGTAT CCCAATCAAC GATTCATTTT CGGGTCTCTG ATAGTATTAA GTAATGTTAT GAACATCAAG AGACATTTCA CCGGTTCCAG ACGGTGATTC TCTGTTGAAA  GTGTTCAATG CACGATCAAT CCGAGAAAAC AAGAAAATAT ACACGAACCA AGATTGAATC AGAAGGAGCT CTGAAATAAA TTGTTTAGTA CATCAAAGAG CGAGGAAAGA GCGCTCAATT  GGCGAGTGTA AGAGGCCATA CGACGGGAAG ATAAAACAAG AAGATAAGCA TTCAATCTAT TAACGGAAAC CTTATCATGC ACGACCAGAC ACCACACACC GCATGCATAT TGTGCAATCC  CGGTGAGCAA TGTCCCGACA GATTTGCAGA TTACAGCAAG CTTCGTAGTA CGTCCCCGTG AAAAAAAAAA GGCAGACACA AGGGATGCTC GAGTATCCAA AAGACAAGAT ATAACTCTCG  ATGGAGGAAA GAACACATCA GATCCAAGAA AAACGAATAA CCAAAAGGAA TAAACAATCT CTAGGATTGC TAGACGGCAA CTAAACAAAT CGATCCGAGA AGAGAATTCC ACGCCGTAAT  AACATTGCCG TGACGAACAT AGGCGACAAA AAGTGGGAAC AGAAGACGGG ACTCAGCACA AACCTCTGCC GAGCTCCCGC GGACCTCCCT GAGGACGACC TTGTCGAGAC CGTTGATGCC  CTTGCAGAGC TCCACGTACT TGAAATCATC CGCTGCGTCC GCCATCTCTC AAATCCCATA ACAAAGAAGA CCTAATCCTT CACCTCTCCA CCTTCTCTCT CTCTCTCTCT CTCTCTCTCT  CTAGCAGACC TGCGAGCTCG CGACGAACGG AACGGAAAGG AAGGGGAGAC GCAAAAAATA CCTCCTATAA TTCAGAGCCT CCCCTCATTT ATAGTGGACG AGGACGGAGG AACCTCAAAG  GGACGGGAAG ATCGATGAGT GAGAGGGAAA CAGAGAGAGA GAGAGAGAAT AGATCCTCAG CAAAGACGCA CTCGGATACC AACACCTCCC GAACGACACG TGTCCAGACT CGTTAACCGA  ATGATTTAAA CGAATGTCCA GCGAATAACC ATACCGACAA CCCATCCGGT GATTAGACAT CTGGGAGCAG AGGGGAGGGG TGAACCCACC CAGATCTATC TGCACTGACC CGCCTTTTGG  ACGGCCAGAT GGAGGCTACA CGCTTTCGAC GGCCAATATG TTTTGGGGCC CGCGTCAGTG GCCCACCGCA GGCCCCGTGT CCAGTCATTG CTGTGCCTTC TGGCGGACCT GATCCACCTG  TCGATTCGAC GCATAGAGGA CAAGTTTGAA ACGGCCCAAT TTGACCGGAA ACGAGGGAAG CACGGCCCAG AAAAAGGTTT GGCCCATTTA AAGTCCGCCT TTCATGGCCC AATTGCTGGC  TCGTCGTACC CAGCTGGGTC GGACCGGCAC AGACGCTTTG GGTTTCGCTG CGAAGAAAAT GGAATATAAC TCTGGCACAC CCAGCTTCCA CCTTGTAAAG GGAGAGCCTT TGGTCTGCCC  ATTTTATAAA TATAGAAGAT ACTGGAATAG ATGCTCCTCT CCTTCTCTCT CTATCACTCT CCCCTCGCTC ATCAGCGGCC ATGGAGAGCA CTCGCAGCCT TCTTCTTCTC GGCGCCTTCC  TGATGGCACT CCTGGTGGTG GCTTCGGCTC AGCTCCGGCA GAACTACTAC AGCAACGTCT GCCCCGGCGT TGAGGATATC GTGCGCGGGG CCGTTGAACG GAAGCTTCAG CAGACGTTCA  TCGCTGCCCC GGGAACCCTA CGGCTCTTCT TCCACGACTG CTTCGTCCGA GTGGGTCGCT TCGCCACTAG CCGGTGAATG GTAGGATCGG CAGGGATTAT CGTTCCAGTG ACGGCTTATT  TCTTGGGTTT CCGGGCAGGG ATGCGACGCC TCGGTGATGA TCAGCGATCC CAAGGGTAAC GACGAGAAAG ACAGCTCCGA CGGCATTTCT CTCGCCGGAG ATGGCTTCGA CACCGTGGTC  AAAGCGAAGG CGGCCGTCGA CGCAGTCGTC GGCTGCACCA ACCAGGTTTC CTGCGCCGAC ATACTGGCCA TGGCTGCGAG AGACGTCGTG TCACTGGTAA TCCATCTGGT ATATAAGCTT  ACTCTGATCA TTATCAGTTG ATTTTGAGTG ATGTCCCAGA CTGGCGGGCC TTTCTTCCCC GTCGAGTTGG GCCGGCGGGA CGGCCGGACC TCGACAAAAG CGGGCGTCAG GCATAAGCTT  CCCCTCCCCC GATTCACCCT GGACCAGCTC AATGCCATGT TCGCCTCCCG CGGGCTTTCA CAGACGGACA TGATCGCTCT CTCAGGTCAA CTCCGTCATC CTCGCCTTCT TCGCAGAACG  ACTGATTCAT GATGCCGTCG TATGATCACC AGGGGCGCAC ACCATCGGGT TCTCTCACTG CTCCAGGTTC TCCAGCAGGA TCTACAGGTA CAGCAAGACG AGGGCCGTGG ACCCATCCAT  GAACAAGGCC TACGTCCTGA AACTTCGGAA GGATTGCCCC GCTGGTGTTG ACCCCGGTGT CGTCGTCAAC CTGGACCCAA GCACGCCGCA GGCTTTCGAC AACGCTTACT TCCAGAACCT  GCAGAAGGGG ATGGGCCTGT TGGCGTCCGA CCAGGTCCTC TTCACGGACA CGAGGTCAAG AGAGACCGTC AATCTGTTCG CCGCCAACAG GACCGCCTTC GAGGAGGCCT TCGCCGCCGC 
CATGATCAAG CTCGGCAGGG TCGACCTGAA GACCGGGAGC CGGGGGGAGG TTCGCCGGGA CTGCTCCTCC GTCAACAGCT AG 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGCACTCGCAGCCTTCTTCTTCTCGGCGCCTTCCTGATGGCACTCCTGGTGGTGGCTTCGGCTCAGCTCCGGCAGAACTACTACAGCAACGTCTGCCCCGGCGTTGAGGATATC
GTGCGCGGGGCCGTTGAACGGAAGCTTCAGCAGACGTTCATCGCTGCCCCGGGAACCCTACGGCTCTTCTTCCACGACTGCTTCGTCCGA
GTGGGTCGCTTCGCCACTAGCCGGTGAATG
GTAGGATCGGCAGGGATTATCGTTCCAGTGACGGCTTATTTCTTGGGTTTCCGGGCAGGGATGCGACGCCTCGGTGATGATCAGCGATCCCAAGGGTAACGACGAGAAAGACAGCTCCGA
CGGCATTTCTCTCGCCGGAGATGGCTTCGACACCGTGGTCAAAGCGAAGGCGGCCGTCGACGCAGTCGTCGGCTGCACCAACCAGGTTTCCTGCGCCGACATACTGGCCATGGCTGCGAG
AGACGTCGTGTCACTG
GTAATCCATCTGGTATATAAGCTTACTCTGATCATTATCAGTTGATTTTGAGTGATGTCCCAGACTGGCGGGCCTTTCTTCCCCGTCGAGTTGGGCCGGCGGGA
CGGCCGGACCTCGACAAAAGCGGGCGTCAGGCATAAGCTTCCCCTCCCCCGATTCACCCTGGACCAGCTCAATGCCATGTTCGCCTCCCGCGGGCTTTCACAGACGGACATGATCGCTCT
CTCAG
GTCAACTCCGTCATCCTCGCCTTCTTCGCAGAACGACTGATTCATGATGCCGTCGTATGATCACCAGGGGCGCACACCATCGGGTTCTCTCACTGCTCCAGGTTCTCCAGCAGGA
TCTACAGGTACAGCAAGACGAGGGCCGTGGACCCATCCATGAACAAGGCCTACGTCCTGAAACTTCGGAAGGATTGCCCCGCTGGTGTTGACCCCGGTGTCGTCGTCAACCTGGACCCAA
GCACGCCGCAGGCTTTCGACAACGCTTACTTCCAGAACCTGCAGAAGGGGATGGGCCTGTTGGCGTCCGACCAGGTCCTCTTCACGGACACGAGGTCAAGAGAGACCGTCAATCTGTTCG
CCGCCAACAGGACCGCCTTCGAGGAGGCCTTCGCCGCCGCCATGATCAAGCTCGGCAGGGTCGACCTGAAGACCGGGAGCCGGGGGGAGGTTCGCCGGGACTGCTCCTCCGTCAACAGCT
AG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGCACTCGCAGCCTTCTTCTTCTCGGCGCCTTCCTGATGGCACTCCTGGTGGTGGCTTCGGCTCAGCTCCGGCAGAACTACTACAGCAACGTCTGCCCCGGCGTTGAGGATATC
GTGCGCGGGGCCGTTGAACGGAAGCTTCAGCAGACGTTCATCGCTGCCCCGGGAACCCTACGGCTCTTCTTCCACGACTGCTTCGTCCGA
GGATGCGACGCCTCGGTGATGATCAGCGAT
CCCAAGGGTAACGACGAGAAAGACAGCTCCGACGGCATTTCTCTCGCCGGAGATGGCTTCGACACCGTGGTCAAAGCGAAGGCGGCCGTCGACGCAGTCGTCGGCTGCACCAACCAGGTT
TCCTGCGCCGACATACTGGCCATGGCTGCGAGAGACGTCGTGTCACTG
ACTGGCGGGCCTTTCTTCCCCGTCGAGTTGGGCCGGCGGGACGGCCGGACCTCGACAAAAGCGGGCGTCAGG
CATAAGCTTCCCCTCCCCCGATTCACCCTGGACCAGCTCAATGCCATGTTCGCCTCCCGCGGGCTTTCACAGACGGACATGATCGCTCTCTCAG
GGGCGCACACCATCGGGTTCTCTCAC
TGCTCCAGGTTCTCCAGCAGGATCTACAGGTACAGCAAGACGAGGGCCGTGGACCCATCCATGAACAAGGCCTACGTCCTGAAACTTCGGAAGGATTGCCCCGCTGGTGTTGACCCCGGT
GTCGTCGTCAACCTGGACCCAAGCACGCCGCAGGCTTTCGACAACGCTTACTTCCAGAACCTGCAGAAGGGGATGGGCCTGTTGGCGTCCGACCAGGTCCTCTTCACGGACACGAGGTCA
AGAGAGACCGTCAATCTGTTCGCCGCCAACAGGACCGCCTTCGAGGAGGCCTTCGCCGCCGCCATGATCAAGCTCGGCAGGGTCGACCTGAAGACCGGGAGCCGGGGGGAGGTTCGCCGG
GACTGCTCCTCCGTCAACAGCTAG

Retrieve as FASTA