Entry information : SpolPrx19 ( Spipo6G0030300)
Entry ID 13219
Creation 2015-06-09 (Christophe Dunand)
Last sequence changes 2015-06-09 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-03-07 (Catherine Mathe)
Peroxidase information: SpolPrx19 ( Spipo6G0030300)
Name (synonym) SpolPrx19 ( Spipo6G0030300)
Class Class III peroxidase    [Orthogroup: Prx184]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Araceae Spirodela
Organism Spirodela polyrhiza (great duckweed)    [TaxId: 29656 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SpolPrx19
start..stop
S start..stop
SpolPrx24 572 0 1..321 5..325
SpolPrx23 559 0 1..289 5..293
SpolPrx38 407 1e-143 5..321 7..330
CsaPrx38 362 1e-125 5..319 20..339
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2740933..2741139 207 N° 2 2740038..2740796 759  
complement(join(2740038..2740796,2740933..2741139))


exon

Literature and cross-references SpolPrx19 ( Spipo6G0030300)
DNA ref. Phytozome 12:   pseudo6 (2741139..2740038)
Cluster/Prediction ref. Phytozome Gene 12:   31505872
Protein sequence: SpolPrx19 ( Spipo6G0030300)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (301)
PWM (Da):   %s   34381.47 (32262.3)  
PI (pH):   %s   7.8 (7.85) Peptide Signal:   %s   cut: 21 range:21-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLVSCIAFLLALQAVAPVAASHSLKVGFYKRSCPQAQTVVRDVVSNALAANKGIGAGLIRLHFHDFSVRGCDASVLLEGSDSERMHPANLNSLRGFEVVEQAKDLLESQCPNTVSCADVLAFAARDAAEFLGGFRYQVPAGRRDGTISRNSDADVLPPATASAEVLRESFRNKGLSLEDMVALPGAHSLGVSHFPAFSGRLYNFNATHPQDPSLDAGLADYLKGRCPPPGTDRTTVSLDLATPNRLDVQYYRNLQKGRGLLTSDQTLWTSSLTADKVASFAEKPNAWAKKYTAAMVRMGAIDVLTGNEGEIRVKCAVVNGH*

Retrieve as FASTA  
Remarks
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAGATAAAAA AAAGTAAATT TTAAGACTAA AACCTTGGAT TTTATCATTA AAGAAGAATT TATAATAATT TCACAAATAA TTCAAGATTA CTAATTCGTT GAAGATATAT ACAACACCAC  TCACATAATT TAGGCATATA AATAAAAAAA TTGATTATTT GTTCATTTAA ACATGCGATA GTGATTTTAT AATAAACTTC CATTTGTAAC CATCAAGATC AGGGGTATCA ACAATATTTC  CATTTTTCAT GCTTACAAAT TCATCTCCTT GGAGACCAAC TTTTTCATAT CAAAAATAGC TATTGGCATC TCATCCTTTC ACATAGTTTG CTCTCCTCTT AGAACCTAAT TTCCTTAGTG  TCTAATGAAA AGAAAAAGTT CTAATGGTTG AGTTGAATTT TTTTGGATTT AGTTGTTGAA AATGATGTAA TATTGCTTTT CTCTACTGAT CTATGTGCCA CAAAAAGGTT GATGATGAGC  CTTAAGTCTT TGTGTAGTCA TTTAGTTTTT AGTCCAAAAC TCCTCTCCTA TAAGTAAGGC TTTTCTCGCT TTTATTTCTC TGTTTTATCA GACTACTCAC ATTCAAAATC TTCGTTTAAA  AGTTTGTAGT TTTTTAGAAC ATACAATAAA GATATCTAGA CTTTCCAATC TCTAAGTTTC TCTATCCTTG CAACCATTTA TGTTCAAACT TGACTAGAAG CTTTCTAGCT CGATGGAGAA  CAGGTCATTG TCTACATTAG ATCCAAATTA GGACGTTTGT ATTTACATTT GTCCTAATAA CAAAGTGATG TGTCATGTCA TGGTGCATTC TTTGAGACTT TAATATCGGA TCATTCTCTA  ATTCTCTTAC TTGCTTAATA CTTGTGATAT AACCTTGGAA ATCTATCTAA AATTATTTTT AAATGATAAT CATTGCATAA TATTAGTATA TTAGGATATA ATTCATGATC AAATATTTCA  TGTATTAAGT TTTATCAACA AAGTTTTATT TGTAAAAGTA TCACCCTTAT GAACCTATGT GTTGATACCT TTGGGCATGG ATTTTGATAT TATAATTATA TGAAAAAATA TATAATTCAT  GATTGATATT ATTCACAATG TTATCATAAA TACTTCATAA ATTTTATGTA AATAAATCTA TTATTTATCT TGTGACATTA TGCCTAACCT TGAGATTAAG TGAAATGATA AATAGGTGAA  ACATCACATA TAGATAAATA TTTGTTAGAA AACAAATATT TAATAAGTAA ATGATAGTTA TCTTTTTAAA TTATTAATTC ATAATTATTT CATCATTTAA GTGCAACTAT TATATATTAG  TCATGTGCAT CAATTAAAAA AAAAAGTTTG AAATATCAAA TGAGCTTTTG TGAGTCTTAA ATCAGTAATT TAGATAATGA CATGTTAGCT GTTTACAAGG AGAAAACATG TTATCTTTTT  TCCCGACTCT CACCAACTAA CGATGTGACA TCGTTGCATG GCCCACATTG TAATATCTAT AAATCACCTT ACCATCCAAA AAATATACCC CGGAAATGCG GATACATTGC TTATATGTCT  GTGCCCACGA CACACATCAC ACGCGGGATA AGGTTCCAGT AATCTATGAA GGCAACTGGA CTATCGGATC AGAGTAACCG TTCCAAGCGC ATGGTTCACT ATTTTCGGGT TGCTTTTGGA  TGAAAGATTG ACCCGAGGCT CCTCAGTCCA AAAGGGGAGG AAAGAGAACG GGTCAGACAA CACGTTTGAA GAATGCTCGT TATTTAATGA CAGAACCTAG TAAAAAATGT CTTCCTCGAG  GTATCTATAA ACTAGCATCC ATCCAGTGAT TAGGAGGTCA CCCCACCTCT CGCCTAACAC CTCTCATAGC CCATTTCTCC GAGCTCTTCG AATCTCCATC ACCCTCGCTC ACCTCTTCTT  CGGAAGGAAC GCCCAGGAGC CGGGAAACCC AGCACGGCAG GAAGAGACTG AAGGGGATTT CTGCAGCAGT GTTGCGAACC ATGTTGGTTT CGTGCATCGC GTTCCTGCTG GCCCTCCAGG  CCGTGGCTCC CGTAGCTGCC TCGCATTCTC TGAAGGTGGG GTTTTACAAG CGGAGCTGTC CCCAGGCACA GACCGTCGTC AGAGACGTCG TGAGCAACGC CCTCGCCGCC AACAAGGGGA  TAGGCGCAGG GCTTATCAGG CTTCACTTCC ACGACTTCTC CGTCAGGGTA CGCCACTATC GCCTCTCCTC TATCGTCCAG CCGTCATTCA TGATGGCTGC CAACTGGTGA CTGTTCCGAT  AGCGTAATCT TATACCCTCC GGACTTGTCG ACGTCTGACT CTCCTACGTA AACTTGCGAA CAGGGCTGTG ACGCCTCCGT TCTGCTGGAA GGCAGCGACT CGGAGAGGAT GCATCCGGCC  AACTTAAACA GCCTGCGGGG TTTCGAGGTG GTCGAGCAGG CCAAGGATCT CCTGGAATCG CAGTGCCCCA ATACGGTGTC ATGCGCCGAC GTCCTGGCCT TCGCCGCCCG CGACGCCGCG  GAATTCTTAG GCGGTTTCCG CTACCAGGTC CCGGCGGGAA GGCGGGACGG GACGATATCC CGGAACTCCG ACGCCGACGT CCTTCCGCCG GCCACCGCTA GTGCTGAGGT TCTCCGTGAA  AGCTTCAGGA ACAAGGGGTT ATCGCTAGAA GACATGGTGG CGCTCCCCGG TGCTCATTCT CTCGGCGTCT CCCACTTCCC GGCCTTCTCT GGCAGGCTGT ACAACTTCAA CGCCACCCAC  CCGCAGGATC CCTCCTTGGA CGCCGGCCTT GCCGACTACC TCAAGGGGCG GTGCCCGCCT CCGGGAACCG ACCGCACCAC CGTGTCCCTG GACCTCGCCA CGCCTAATCG CCTGGACGTG  CAGTACTACA GAAACCTGCA GAAGGGGAGG GGGCTGTTAA CCTCCGACCA GACGCTGTGG ACCAGCTCTC TTACGGCGGA CAAGGTGGCG TCGTTCGCTG AGAAGCCCAA CGCCTGGGCG 
AAGAAGTACA CGGCCGCCAT GGTGCGGATG GGTGCCATCG ACGTGCTGAC TGGGAACGAG GGCGAGATCA GGGTCAAGTG CGCTGTGGTC AACGGCCATT AA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGGTTTCGTGCATCGCGTTCCTGCTGGCCCTCCAGGCCGTGGCTCCCGTAGCTGCCTCGCATTCTCTGAAGGTGGGGTTTTACAAGCGGAGCTGTCCCCAGGCACAGACCGTCGTC
AGAGACGTCGTGAGCAACGCCCTCGCCGCCAACAAGGGGATAGGCGCAGGGCTTATCAGGCTTCACTTCCACGACTTCTCCGTCAGG
GTACGCCACTATCGCCTCTCCTCTATCGTCCAG
CCGTCATTCATGATGGCTGCCAACTGGTGACTGTTCCGATAGCGTAATCTTATACCCTCCGGACTTGTCGACGTCTGACTCTCCTACGTAAACTTGCGAACAGGGCTGTGACGCCTCCGT
TCTGCTGGAAGGCAGCGACTCGGAGAGGATGCATCCGGCCAACTTAAACAGCCTGCGGGGTTTCGAGGTGGTCGAGCAGGCCAAGGATCTCCTGGAATCGCAGTGCCCCAATACGGTGTC
ATGCGCCGACGTCCTGGCCTTCGCCGCCCGCGACGCCGCGGAATTCTTAGGCGGTTTCCGCTACCAGGTCCCGGCGGGAAGGCGGGACGGGACGATATCCCGGAACTCCGACGCCGACGT
CCTTCCGCCGGCCACCGCTAGTGCTGAGGTTCTCCGTGAAAGCTTCAGGAACAAGGGGTTATCGCTAGAAGACATGGTGGCGCTCCCCGGTGCTCATTCTCTCGGCGTCTCCCACTTCCC
GGCCTTCTCTGGCAGGCTGTACAACTTCAACGCCACCCACCCGCAGGATCCCTCCTTGGACGCCGGCCTTGCCGACTACCTCAAGGGGCGGTGCCCGCCTCCGGGAACCGACCGCACCAC
CGTGTCCCTGGACCTCGCCACGCCTAATCGCCTGGACGTGCAGTACTACAGAAACCTGCAGAAGGGGAGGGGGCTGTTAACCTCCGACCAGACGCTGTGGACCAGCTCTCTTACGGCGGA
CAAGGTGGCGTCGTTCGCTGAGAAGCCCAACGCCTGGGCGAAGAAGTACACGGCCGCCATGGTGCGGATGGGTGCCATCGACGTGCTGACTGGGAACGAGGGCGAGATCAGGGTCAAGTG
CGCTGTGGTCAACGGCCATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGGTTTCGTGCATCGCGTTCCTGCTGGCCCTCCAGGCCGTGGCTCCCGTAGCTGCCTCGCATTCTCTGAAGGTGGGGTTTTACAAGCGGAGCTGTCCCCAGGCACAGACCGTCGTC
AGAGACGTCGTGAGCAACGCCCTCGCCGCCAACAAGGGGATAGGCGCAGGGCTTATCAGGCTTCACTTCCACGACTTCTCCGTCAGG
GGCTGTGACGCCTCCGTTCTGCTGGAAGGCAGC
GACTCGGAGAGGATGCATCCGGCCAACTTAAACAGCCTGCGGGGTTTCGAGGTGGTCGAGCAGGCCAAGGATCTCCTGGAATCGCAGTGCCCCAATACGGTGTCATGCGCCGACGTCCTG
GCCTTCGCCGCCCGCGACGCCGCGGAATTCTTAGGCGGTTTCCGCTACCAGGTCCCGGCGGGAAGGCGGGACGGGACGATATCCCGGAACTCCGACGCCGACGTCCTTCCGCCGGCCACC
GCTAGTGCTGAGGTTCTCCGTGAAAGCTTCAGGAACAAGGGGTTATCGCTAGAAGACATGGTGGCGCTCCCCGGTGCTCATTCTCTCGGCGTCTCCCACTTCCCGGCCTTCTCTGGCAGG
CTGTACAACTTCAACGCCACCCACCCGCAGGATCCCTCCTTGGACGCCGGCCTTGCCGACTACCTCAAGGGGCGGTGCCCGCCTCCGGGAACCGACCGCACCACCGTGTCCCTGGACCTC
GCCACGCCTAATCGCCTGGACGTGCAGTACTACAGAAACCTGCAGAAGGGGAGGGGGCTGTTAACCTCCGACCAGACGCTGTGGACCAGCTCTCTTACGGCGGACAAGGTGGCGTCGTTC
GCTGAGAAGCCCAACGCCTGGGCGAAGAAGTACACGGCCGCCATGGTGCGGATGGGTGCCATCGACGTGCTGACTGGGAACGAGGGCGAGATCAGGGTCAAGTGCGCTGTGGTCAACGGC
CATTAA

Retrieve as FASTA