Entry information : SpolPrx20 (Spipo8G0053300)
Entry ID 13221
Creation 2015-06-09 (Christophe Dunand)
Last sequence changes 2015-06-09 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-02-25 (Catherine Mathe)
Peroxidase information: SpolPrx20 (Spipo8G0053300)
Name (synonym) SpolPrx20 (Spipo8G0053300)
Class Class III peroxidase    [Orthogroup: Prx027]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Araceae Spirodela
Organism Spirodela polyrhiza (great duckweed)    [TaxId: 29656 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SpolPrx20
start..stop
S start..stop
VvPrx37 476 4e-171 13..317 13..316
VvPrx20 470 6e-169 13..317 13..317
EcamPrx191 464 2e-166 12..317 13..317
LePrx72 464 3e-166 7..317 10..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4323025..4323234 210 N° 2 4323316..4323507 192 N° 3 4323612..4324163 552  
join(4323025..4323234,4323316..4323507,4323612..4324163)


exon

Literature and cross-references SpolPrx20 (Spipo8G0053300)
DNA ref. Phytozome 12:   pseudo8 (4323025..4324163)
Cluster/Prediction ref. Phytozome Gene 12:   31511649
Protein sequence: SpolPrx20 (Spipo8G0053300)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (294)
PWM (Da):   %s   34124.32 (31661.9)  
PI (pH):   %s   8.65 (8.58) Peptide Signal:   %s   cut: 24 range:24-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVSIKLLALPLLLSLLVCASQAQLSANFYSSSCPNLQRIVRAAMAQAVSREPRIGASIVRLLFHDCFVNGCDASILLDDTATFTGEKTARPNNNSVRGFNVIDDIKTRVEAACRATVSCADILALAARDGVALLGGPSWTVTFGRRDARTASISDANSQIPPPFADLSTLISSFSAKGLSAQEMTVLSGSHTIGQARCTTFRTRIYNDTNINGPFAARLRGICPTSGRDNVLAPLDLQTPNRFDNRYYQNLLTQRGLLHSDQELFNGGSQDALVRRYSSDNGLFSSDFAAAMVKMSAISPLTGTDGEIRTNCRRVN*

Retrieve as FASTA  
Remarks
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGATGGGTTT TCGTTGGTTC CGATTGCCCA GATCAGCAAA GGCATTCTTC GCAAGTACAT CGGCCCTGTT GATGTCTGGC TGTCGATCTT CCTCTGCCAT CTTCGTCATC CGGACCAGAC  CTGCTGCTTT CTGAATGCGT CTCCTCGCAT GAGCTACCGT GCCATGGCTG AGCACAGGAG CCAGTGGCTA TGGTATGCTT ATGCATGGAT ATATATAATT AATCAATATG TAAAGAGAAA  ATTTCCCAAG TTCTAGCTTC ATTTATTATC GTTTACTTAA CTGGGTAAAT TTCCCTGGTT CTACAGGTTC CGAAAGCTGT TCGTGTTGCT CTCCAGTTAC ACTTACATGA ACACCCTCAG  GAAGGTCAGC GGCCATTAGG GTTTGTAAGC TCCTCAGGAT CTGTCGTGTG CTTATCTGTG CTCTCCGTTA CAATTTTTCT CAATAAATGG GTTATTATAC AGACGACAGC GTCGTTTCTC  GGCCCCTTAT TATCCAAGAG AATAATGTTC ATCGGTCTCT CTCTCTCTCT CTCTCTCTCT CTCCGAACTA TCTTATCCCT CCCTTTATTA AATTATATCC TAAGGAAAAA TATGGATGGT  TATAATTCCT AAAACATTAT CTTAGTTCTT CTAGCGGATT GGCCGGACCG GTGGATGGTT AACCGGTTTG AAGTTGGATT CGGTCTGCGT TGACCAAATC AGGGGGGCAG TTCCATTACA  GATTCGGTCA GCGTAATACC TGCAGGCTGC TGATGCGTTG GCTACCATAA TCCGTCTAGG AATCGTAACG TTAAGCTCGA ATATTTTTTG TAGAAACATT TATTTAATGC AAATAATGGC  GCACATCCAA GACTGTCTAG TGCTTTCAGC TGGGTGCCCA GCCACTTGCT GAACCCAACT ACCCTTGATG GGAATCGGAA TAGCCCATCC CCAAAGAGAG AGAGAGCGAG AGAGAGACAG  AGCGAGAGCG AGAGAGAGAG AGAGAGAGAG AGAGAGGAGn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnAGA GAGAGAGAGA GAGCGTTTCC TGCATGTAAA GTTGTCCACA CACATTTCTC CGTTGCAGCG GCAATAGTTG AAAACTTTGC GGACCTAACC CGCCGCATGT  CACGGTTATT TAAGGACGAG GGGTTTCGTG CAAGCGGAGT ATCACCAGCA GCAACGCTCT CCTAGCCGAT TGGAGCAGCC ATGGCCGTCT CCATCAAGCT CCTCGCGCTC CCTTTACTGC  TCTCCCTCCT CGTCTGCGCC TCCCAGGCGC AGCTCTCCGC TAACTTCTAC TCAAGTAGCT GCCCGAACCT GCAGAGGATT GTCCGCGCCG CCATGGCTCA GGCTGTCAGC CGGGAGCCGA  GGATCGGTGC CTCCATCGTT CGTCTCCTCT TCCACGACTG CTTCGTTAAT GTCCGTGACG TCCACTTCTT CTTCTTCTTC TTCTTCTTCT TCTTCTTCGC CTGTTGACGT GGATTGATGA  AACCCTACCA GGGCTGCGAC GCGTCCATCC TGCTGGACGA CACGGCGACG TTCACCGGAG AGAAGACCGC ACGGCCGAAC AACAACTCCG TGCGGGGCTT CAATGTCATC GACGACATTA  AAACCCGCGT CGAAGCAGCC TGCCGGGCCA CTGTCTCCTG CGCCGACATC CTCGCCCTCG CCGCGCGCGA CGGAGTGGCC CTGGTCAGCG CCATTCCTCT TCTCCCCCTA CATAAAACCC  TAGCAGACTC TCCTTCTTTC GTAAGGAATC AGAAGACAGC TCTCTCATCT CCTGTGGCTC GGTGCAGCTC GGGGGGCCGT CGTGGACTGT GACTTTCGGC CGAAGGGACG CGAGGACGGC  GAGCATCAGC GACGCCAACA GCCAGATCCC GCCGCCGTTC GCCGACCTCT CCACCCTCAT CTCTTCCTTC TCCGCGAAGG GACTCAGCGC CCAGGAAATG ACCGTCCTCT CTGGTTCCCA  CACCATCGGC CAAGCTCGCT GCACCACCTT CCGCACGCGC ATCTACAACG ACACCAACAT CAACGGCCCC TTCGCCGCCA GACTCCGCGG CATCTGCCCC ACCTCCGGCA GGGACAACGT  CTTGGCCCCC CTGGACCTGC AGACCCCCAA CAGATTCGAC AACAGATACT ACCAGAACCT GCTCACCCAG CGCGGTCTTC TCCACTCCGA CCAGGAGCTC TTCAATGGCG GCTCGCAGGA  CGCGCTGGTC CGCCGTTACA GCAGCGACAA CGGCCTCTTC TCCAGCGACT TTGCGGCGGC CATGGTGAAG ATGAGCGCCA TCAGCCCGTT GACCGGCACC GACGGAGAGA TCCGGACGAA 
CTGCAGAAGG GTCAACTGA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTCTCCATCAAGCTCCTCGCGCTCCCTTTACTGCTCTCCCTCCTCGTCTGCGCCTCCCAGGCGCAGCTCTCCGCTAACTTCTACTCAAGTAGCTGCCCGAACCTGCAGAGGATT
GTCCGCGCCGCCATGGCTCAGGCTGTCAGCCGGGAGCCGAGGATCGGTGCCTCCATCGTTCGTCTCCTCTTCCACGACTGCTTCGTTAAT
GTCCGTGACGTCCACTTCTTCTTCTTCTTC
TTCTTCTTCTTCTTCTTCGCCTGTTGACGTGGATTGATGAAACCCTACCAGGGCTGCGACGCGTCCATCCTGCTGGACGACACGGCGACGTTCACCGGAGAGAAGACCGCACGGCCGAAC
AACAACTCCGTGCGGGGCTTCAATGTCATCGACGACATTAAAACCCGCGTCGAAGCAGCCTGCCGGGCCACTGTCTCCTGCGCCGACATCCTCGCCCTCGCCGCGCGCGACGGAGTGGCC
CTG
GTCAGCGCCATTCCTCTTCTCCCCCTACATAAAACCCTAGCAGACTCTCCTTCTTTCGTAAGGAATCAGAAGACAGCTCTCTCATCTCCTGTGGCTCGGTGCAGCTCGGGGGGCCGT
CGTGGACTGTGACTTTCGGCCGAAGGGACGCGAGGACGGCGAGCATCAGCGACGCCAACAGCCAGATCCCGCCGCCGTTCGCCGACCTCTCCACCCTCATCTCTTCCTTCTCCGCGAAGG
GACTCAGCGCCCAGGAAATGACCGTCCTCTCTGGTTCCCACACCATCGGCCAAGCTCGCTGCACCACCTTCCGCACGCGCATCTACAACGACACCAACATCAACGGCCCCTTCGCCGCCA
GACTCCGCGGCATCTGCCCCACCTCCGGCAGGGACAACGTCTTGGCCCCCCTGGACCTGCAGACCCCCAACAGATTCGACAACAGATACTACCAGAACCTGCTCACCCAGCGCGGTCTTC
TCCACTCCGACCAGGAGCTCTTCAATGGCGGCTCGCAGGACGCGCTGGTCCGCCGTTACAGCAGCGACAACGGCCTCTTCTCCAGCGACTTTGCGGCGGCCATGGTGAAGATGAGCGCCA
TCAGCCCGTTGACCGGCACCGACGGAGAGATCCGGACGAACTGCAGAAGGGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTCTCCATCAAGCTCCTCGCGCTCCCTTTACTGCTCTCCCTCCTCGTCTGCGCCTCCCAGGCGCAGCTCTCCGCTAACTTCTACTCAAGTAGCTGCCCGAACCTGCAGAGGATT
GTCCGCGCCGCCATGGCTCAGGCTGTCAGCCGGGAGCCGAGGATCGGTGCCTCCATCGTTCGTCTCCTCTTCCACGACTGCTTCGTTAAT
GGCTGCGACGCGTCCATCCTGCTGGACGAC
ACGGCGACGTTCACCGGAGAGAAGACCGCACGGCCGAACAACAACTCCGTGCGGGGCTTCAATGTCATCGACGACATTAAAACCCGCGTCGAAGCAGCCTGCCGGGCCACTGTCTCCTGC
GCCGACATCCTCGCCCTCGCCGCGCGCGACGGAGTGGCCCTG
CTCGGGGGGCCGTCGTGGACTGTGACTTTCGGCCGAAGGGACGCGAGGACGGCGAGCATCAGCGACGCCAACAGCCAG
ATCCCGCCGCCGTTCGCCGACCTCTCCACCCTCATCTCTTCCTTCTCCGCGAAGGGACTCAGCGCCCAGGAAATGACCGTCCTCTCTGGTTCCCACACCATCGGCCAAGCTCGCTGCACC
ACCTTCCGCACGCGCATCTACAACGACACCAACATCAACGGCCCCTTCGCCGCCAGACTCCGCGGCATCTGCCCCACCTCCGGCAGGGACAACGTCTTGGCCCCCCTGGACCTGCAGACC
CCCAACAGATTCGACAACAGATACTACCAGAACCTGCTCACCCAGCGCGGTCTTCTCCACTCCGACCAGGAGCTCTTCAATGGCGGCTCGCAGGACGCGCTGGTCCGCCGTTACAGCAGC
GACAACGGCCTCTTCTCCAGCGACTTTGCGGCGGCCATGGTGAAGATGAGCGCCATCAGCCCGTTGACCGGCACCGACGGAGAGATCCGGACGAACTGCAGAAGGGTCAACTGA

Retrieve as FASTA