Entry information : SpolPrx24 ( Spipo6G0030200)
Entry ID 13225
Creation 2015-06-09 (Christophe Dunand)
Last sequence changes 2015-06-09 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-02-25 (Catherine Mathe)
Peroxidase information: SpolPrx24 ( Spipo6G0030200)
Name (synonym) SpolPrx24 ( Spipo6G0030200)
Class Class III peroxidase    [Orthogroup: Prx184]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Araceae Spirodela
Organism Spirodela polyrhiza (great duckweed)    [TaxId: 29656 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SpolPrx24
start..stop
S start..stop
SpolPrx19 589 0 5..325 1..321
SpolPrx23 531 0 1..293 1..293
SpolPrx38 416 5e-147 9..325 7..330
CsaPrx37 381 2e-133 1..323 10..337
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2735319..2735537 219 N° 2 2734430..2735188 759  
complement(join(2734430..2735188,2735319..2735537))


exon

Literature and cross-references SpolPrx24 ( Spipo6G0030200)
DNA ref. Phytozome 12:   pseudo6 (2735537..2734430)
Cluster/Prediction ref. Phytozome Gene 12:   31506125
Protein sequence: SpolPrx24 ( Spipo6G0030200)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (301)
PWM (Da):   %s   35219.6 (32601.3) Transmb domain:   %s   i7-24o
PI (pH):   %s   8.05 (8.00) Peptide Signal:   %s   cut: 25 range:25-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLRTMCGCCIVFLLAFQAVAPAAASHSLKVGFYKNSCPQAQNVVRDVVSNALAANKGIGAGLIRLHFHDCFVRGCDASVLLEGSDSERMNRANINSLRGFEVVEQAKDLLESQCPNTVSCADVLAFAARDAAEFLGGFRYQVPAGRRDGTVSRNSDADVLPGPRDSAEVLRESFENKGLSLEDMVALSGAHSLGVSHCPTFSNRLYNFNATHPQDPSMDADLADYLKERCPPPGTDRTTVSLDLATPNRLDVQYYRNLQRGRGLLTSDQTLWTSPITADKVASFAKKPNRWAKKYAAAMVRMGAIDVLTGNKGEIRVKCAVVNGH*

Retrieve as FASTA  
Remarks
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnCTCAACCT TTAAAAATTG AACTATTATA ATGTCGACGA  TTCTATGACC AGTGAGATCA TTGGTCAAAG AACCAAGGCA CCGATTGGAA CAAGTCAGGC TCCTCCTGCA CACGTTTTGA TCGCCCATAT TCTTGAAGCG TGAAACGAAG AGGTCAAAAA  TGTCTTCCTA GAGGCATCGA TAAATAAGGC TCCATTGATT GATTAGGAGT CATCTCACCT CTCGACTCAC ACCTCTCATA TCACCATTCT CCGAGCTCCA CCAACCTCTA TCCCCCTCGC  TCACCTCTTT TTCGGAGGGA ACGCTCAAGA ACCGGGAAAC CCAGCACGAC AGGAAGAGGC TGAAGGGGAC TTGTGGAGCA ATGCTGCGAA CCATGTGCGG ATGCTGCATC GTGTTCCTGC  TGGCCTTCCA GGCCGTGGCT CCCGCAGCTG CCTCGCATTC TCTGAAGGTG GGGTTTTACA AGAACAGCTG CCCCCAGGCA CAGAACGTCG TCAGAGACGT CGTGAGCAAC GCCCTCGCCG  CCAACAAGGG GATAGGCGCG GGACTTATCA GGCTGCACTT TCACGACTGC TTCGTCAGGG TACGCTACCG CCGCCTTTCT TCCTTCGTCC GTCTACTCAA AATGCGTCTC ATCTGAAGAC  GCTCCGTACA ACATCTTGTA CCCACCGGAC TTGTCGACGT CTGACTCTCC TACGTAAATT TGCGAACAGG GATGTGACGC CTCCGTTCTG CTGGAAGGCA GCGACTCGGA GAGAATGAAT  CGCGCCAACA TAAACAGCCT GCGGGGTTTC GAGGTGGTCG AGCAGGCCAA GGATCTCCTG GAATCGCAGT GCCCCAATAC GGTGTCATGC GCCGACGTCC TGGCCTTCGC CGCCCGCGAC  GCCGCGGAAT TCTTAGGCGG TTTCCGCTAC CAGGTCCCGG CGGGAAGGCG GGATGGGACG GTATCCCGGA ACTCCGACGC CGACGTCCTT CCGGGGCCCA GGGATAGTGC CGAGGTCCTC  CGTGAAAGCT TCGAGAACAA GGGGTTATCG CTAGAAGACA TGGTGGCGCT CTCCGGCGCT CACTCTCTCG GCGTCTCCCA CTGCCCGACC TTCTCCAACA GGCTGTACAA CTTCAACGCC  ACCCACCCGC AGGATCCCTC CATGGACGCC GACCTTGCCG ACTACCTCAA GGAGCGGTGC CCGCCTCCGG GAACCGACCG CACCACCGTG TCCCTGGACC TCGCCACACC GAATCGCCTG  GACGTCCAGT ACTACAGAAA CCTGCAGAGG GGGAGGGGGC TGCTCACCTC CGACCAGACG CTGTGGACCA GCCCTATAAC GGCGGACAAG GTGGCGTCGT TCGCCAAGAA GCCCAACCGC 
TGGGCGAAGA AGTACGCGGC CGCCATGGTG CGGATGGGTG CCATCGACGT GCTGACTGGG AACAAGGGCG AGATCAGGGT CAAGTGCGCT GTGGTGAACG GCCACTAA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGCGAACCATGTGCGGATGCTGCATCGTGTTCCTGCTGGCCTTCCAGGCCGTGGCTCCCGCAGCTGCCTCGCATTCTCTGAAGGTGGGGTTTTACAAGAACAGCTGCCCCCAGGCA
CAGAACGTCGTCAGAGACGTCGTGAGCAACGCCCTCGCCGCCAACAAGGGGATAGGCGCGGGACTTATCAGGCTGCACTTTCACGACTGCTTCGTCAGG
GTACGCTACCGCCGCCTTTCT
TCCTTCGTCCGTCTACTCAAAATGCGTCTCATCTGAAGACGCTCCGTACAACATCTTGTACCCACCGGACTTGTCGACGTCTGACTCTCCTACGTAAATTTGCGAACAGGGATGTGACGC
CTCCGTTCTGCTGGAAGGCAGCGACTCGGAGAGAATGAATCGCGCCAACATAAACAGCCTGCGGGGTTTCGAGGTGGTCGAGCAGGCCAAGGATCTCCTGGAATCGCAGTGCCCCAATAC
GGTGTCATGCGCCGACGTCCTGGCCTTCGCCGCCCGCGACGCCGCGGAATTCTTAGGCGGTTTCCGCTACCAGGTCCCGGCGGGAAGGCGGGATGGGACGGTATCCCGGAACTCCGACGC
CGACGTCCTTCCGGGGCCCAGGGATAGTGCCGAGGTCCTCCGTGAAAGCTTCGAGAACAAGGGGTTATCGCTAGAAGACATGGTGGCGCTCTCCGGCGCTCACTCTCTCGGCGTCTCCCA
CTGCCCGACCTTCTCCAACAGGCTGTACAACTTCAACGCCACCCACCCGCAGGATCCCTCCATGGACGCCGACCTTGCCGACTACCTCAAGGAGCGGTGCCCGCCTCCGGGAACCGACCG
CACCACCGTGTCCCTGGACCTCGCCACACCGAATCGCCTGGACGTCCAGTACTACAGAAACCTGCAGAGGGGGAGGGGGCTGCTCACCTCCGACCAGACGCTGTGGACCAGCCCTATAAC
GGCGGACAAGGTGGCGTCGTTCGCCAAGAAGCCCAACCGCTGGGCGAAGAAGTACGCGGCCGCCATGGTGCGGATGGGTGCCATCGACGTGCTGACTGGGAACAAGGGCGAGATCAGGGT
CAAGTGCGCTGTGGTGAACGGCCACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGCGAACCATGTGCGGATGCTGCATCGTGTTCCTGCTGGCCTTCCAGGCCGTGGCTCCCGCAGCTGCCTCGCATTCTCTGAAGGTGGGGTTTTACAAGAACAGCTGCCCCCAGGCA
CAGAACGTCGTCAGAGACGTCGTGAGCAACGCCCTCGCCGCCAACAAGGGGATAGGCGCGGGACTTATCAGGCTGCACTTTCACGACTGCTTCGTCAGG
GGATGTGACGCCTCCGTTCTG
CTGGAAGGCAGCGACTCGGAGAGAATGAATCGCGCCAACATAAACAGCCTGCGGGGTTTCGAGGTGGTCGAGCAGGCCAAGGATCTCCTGGAATCGCAGTGCCCCAATACGGTGTCATGC
GCCGACGTCCTGGCCTTCGCCGCCCGCGACGCCGCGGAATTCTTAGGCGGTTTCCGCTACCAGGTCCCGGCGGGAAGGCGGGATGGGACGGTATCCCGGAACTCCGACGCCGACGTCCTT
CCGGGGCCCAGGGATAGTGCCGAGGTCCTCCGTGAAAGCTTCGAGAACAAGGGGTTATCGCTAGAAGACATGGTGGCGCTCTCCGGCGCTCACTCTCTCGGCGTCTCCCACTGCCCGACC
TTCTCCAACAGGCTGTACAACTTCAACGCCACCCACCCGCAGGATCCCTCCATGGACGCCGACCTTGCCGACTACCTCAAGGAGCGGTGCCCGCCTCCGGGAACCGACCGCACCACCGTG
TCCCTGGACCTCGCCACACCGAATCGCCTGGACGTCCAGTACTACAGAAACCTGCAGAGGGGGAGGGGGCTGCTCACCTCCGACCAGACGCTGTGGACCAGCCCTATAACGGCGGACAAG
GTGGCGTCGTTCGCCAAGAAGCCCAACCGCTGGGCGAAGAAGTACGCGGCCGCCATGGTGCGGATGGGTGCCATCGACGTGCTGACTGGGAACAAGGGCGAGATCAGGGTCAAGTGCGCT
GTGGTGAACGGCCACTAA

Retrieve as FASTA