Entry information : SpolPrx32 (Spipo1G0079200)
Entry ID 13234
Creation 2015-06-09 (Christophe Dunand)
Last sequence changes 2015-06-09 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-02-25 (Catherine Mathe)
Peroxidase information: SpolPrx32 (Spipo1G0079200)
Name (synonym) SpolPrx32 (Spipo1G0079200)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Araceae Spirodela
Organism Spirodela polyrhiza (great duckweed)    [TaxId: 29656 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SpolPrx32
start..stop
S start..stop
SpolPrx29 592 0 4..330 2..328
SpolPrx[P]33 468 1e-167 4..324 2..320
EcamPrx43 429 2e-152 11..330 5..321
EgrPrx43 427 1e-151 11..330 5..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4922789..4923013 225 N° 2 4922482..4922673 192 N° 3 4922203..4922368 166 N° 4 4921675..4922084 410
complement(join(4921675..4922084,4922203..4922368,4922482..4922673,4922789..4923 013))


exon

Literature and cross-references SpolPrx32 (Spipo1G0079200)
DNA ref. Phytozome 12:   pseudo1 (4923013..4921675)
Cluster/Prediction ref. Phytozome Gene 12:   31521219
Protein sequence: SpolPrx32 (Spipo1G0079200)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (304)
PWM (Da):   %s   35927.32 (33145.8)  
PI (pH):   %s   8.63 (8.72) Peptide Signal:   %s   cut: 27 range:27-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGPGPRISGEIVFLALVLLMCLNATAESTLRVGYYEKTCPQAEFIVKKVIAKATKTDNGLPADFIRMHFHDCFVRGCDGSILIDSTSNNTAEKDSPINNPSLEGFEIIDEAKAKLEKKCKGVVSCADILAFAARDSVELSGGFWYEVPSGRRDGRISRSSETFGNLAPPSFNLSQLTQNFASKGLNLDDLVTLSGAHTIGKSHCTSINSRLHNFSSTATTDPSLDPAYAKKLKKKCPKGSTDPNLTVPMDPPSPEVFDSSYYKNILVHKGLFHSDQALLSSSKTANLVKQNAANEHLFKKRFAEAMVKMGNIEVLTGKKGEIRLNCRVIN*

Retrieve as FASTA  
Remarks
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTGTGCGGCA TTCCATACGA AGTCACTTGT CGCCGGGGTG CTGTTGTCGA TGTCACTGGA TGCCGCTAGG ACGGATGTCC CGATGCCAGA AGTGGCAGTT GTTGATGTGG CGTGTGGTGG  AGGCAGTGGT TCCGTAGGTA GTTGCTAGAG CTCCAAGTGA GAGAGACATT CAAAAAGGGC GTTCACTGAG TCGACAAGTT TACGAGCCCA TTCGGGGGTA TCGGAGAGGA GGGAGGTGAA  CTGGTGATAG AGTATTTGGT GCCCAGATGG GTGCACATGC GGAGGTAGGG TTGACTGGCT CTGATACCAC TCTGTTGCGG CAAGCTGGGG GAGTAAAGGA GACGAGAGGG GAAAATGGTA  GTGGGAGGAG TCGAAGAGGG AGTGAACTGC TCACAAGGAT GCCATCACGG TGGAGCCGAA CCCCGAAGGG AACCAAATTT CTATATTTCG ATTGCTGCTT TCCCCCGTCC GAGGGGGGGG  GGTGTTTTAA AACAAACTCA ACTCTCACAC GACAATGAAA TAGAAAGCGC TAGTGGTCAA CGACGATGTC GCCGGTCAGC TAATAGTAGA CGAAGGCGTC GTCGACTTTA CCAATCCTGG  TCCTCTGGGG GTAGCGGTTG CCGTGGGGGT GACGGTGTCA AGCGACGGGG CGTCTATCTC TGCATGCTCA GCTGATGCAC CAGCCCAATA ATCAGAACTA GAGTCCATTT GTCGTACTGT  CCCGCGAACC ATCAGTTCCT GATCCCCATC AGTATGCCAC TTGATTGTGT CCACGGTCTG ATGGTAATGA GGTTTTCGAA TCAACGGCAT TATATCGCGA TCATGACGAG GCTTTTCTGT  CTTGTTCACA CTCAGAGGCA TTATTGGAAG GTGGAATGGA GCTCTCAATG TTTTAGCTCT TATGTCTGGT TGCCAACTAC TCATCAGTAG GCATACATCA ATAGCTACAG AAAAACTGCT  CAAATATATT GTCATAAGAT AACACGAAGC CGTTGAGAAG TCAATTCGAG ATGGATCTTT TGTCCGTGAG AAGTTTGCGG AATTTCCCTG TCGGGGTCTG ATTTTTCCAT TCTTTGACAT  GAACAGCGAC CGACTCCGTC GGGCCAGTTC CTCACCAAAT CCTTTCTGCT AGTCGCGACA TAAGTGACCA TCACTACCGT TCGGGATGAG AGTTGCCTTG GTACTCGCAC CTGCTCATTG  TCCAGGTTAC ACTTCCCTCC AGTAAGAGTT TTCTTTCAGT ACAAATGTAC ATAGCACTAT TGGTAAGAGG AATCAGAAAC TCAACTTAAA ACTATTCAAC TTGACAGCAG AAAAAAATAC  CGGAGACATG AGAAGAAATC CGCGATCGTC GTGACATTAT CTTCTCTACA ATAATTAAGT TGCCGTCACA TCGAAGCGTG ACAGACACAC GTCTCTTGTG GAAGAGCACA TCATAGCACA  TCATATTGAA TGACGATGAA TTTCTCCCTG AATTCAGGCT TTCACACACA AAAAAGACCC ATACTCATCA ATCTAGGGGA CAAATCAAAG GGCCAAAAGA TTTACAGAGT GCGTACTTCA  AGAAGTTCAA CATACCTCCC ACTTGAGGGA TCAGGTGTGT TCTCTGATTC GGAAGAATCT TAGCGATCTT AAAAACAGTT CATCTCGACA TCCAATTGGT ATTGCGGAAC GATAAAGTGT  TGAGGTTACT ATCATTATCA TGCTTCTTAA GAATCAAACT CTTGAGTTTC AGATGACTTG GTCGCTGGTC AACAGTGGGT GCCGTCACCA TCCGGACGAG CTGTTAAGAT CTATATTCAA  GGAAACCACC CTCATTCAAC CACAACCTAA TACTTTCTCA CGATACGCTA GTACCCAACC ACCACGAACC AACTCTGCCC CACCATAATC CACTTAAATG GATAATCAAT AATTTCCATT  AAAATACTAG AGGGCTGTGG ATCCCGTGAT TATAAGTAAG GCAGCGGAAT GCATGCAAAG GTATCAGGGC CTGAGCGATC ATGGGGCCGG GGCCGAGGAT AAGTGGGGAG ATAGTGTTCT  TGGCCCTGGT GCTTCTAATG TGTCTCAATG CTACGGCAGA ATCTACGCTT CGAGTCGGTT ATTACGAAAA GACATGTCCC CAAGCAGAGT TTATCGTGAA GAAGGTTATA GCGAAGGCGA  CGAAGACGGA CAATGGTCTA CCCGCCGATT TCATCAGGAT GCATTTTCAC GACTGTTTCG TGAGGGTGTG TTACGTAGCC AGTTACGCCG ATATTTATGT CTCTCGTCGA AAAGAAGATT  ATGCTCGATT ACCGTAGCTC GTCAACGGCG GTTTATCTTC TTTCCTTCTG ATGTTTTTAG GGTTGCGACG GATCAATTCT TATCGACTCC ACCTCGAACA ACACCGCCGA GAAGGACTCA  CCCATCAACA ACCCAAGCCT GGAAGGGTTC GAGATCATCG ACGAGGCCAA GGCCAAGCTG GAGAAGAAGT GCAAGGGTGT CGTGTCCTGC GCCGACATCC TCGCTTTTGC TGCCAGAGAT  AGTGTTGAGC TGGTAGAATC AATGCCCTAA TGTTCTTAAC TTGATCGTAT CACTTGCGTA CACAAGACTT GGTGTCCCTG TGGATGAGCA TGGCTCTGCT CGGCTGACTT TGTTCGTGAC  TGCAGAGCGG AGGATTTTGG TACGAAGTCC CCTCGGGAAG GAGGGACGGA AGGATCTCCC GTAGTTCAGA GACATTCGGA AACTTGGCGC CTCCGTCATT CAATTTATCA CAGCTCACAC  AGAACTTTGC CAGCAAGGGT CTGAACCTGG ACGACTTGGT CACCCTCTCT GGTATGAAGA ATATAAACGT TTAAAGAGAT CTGTCAGTGG AACTTGAACA CAATTGAACC CATATATTGT  GATTCCTACG ATTTTATTTT CTCATGCGGA ACTATTCTTG TAATTTCAGG GGCGCACACC ATCGGCAAGT CTCACTGCAC CAGCATCAAC AGTCGGCTGC ACAACTTCAG TTCGACAGCC  ACCACCGATC CGAGCTTGGA TCCGGCTTAC GCGAAGAAAT TGAAGAAGAA GTGTCCCAAA GGGAGCACCG ACCCGAACCT GACCGTCCCG ATGGACCCTC CCAGTCCTGA GGTCTTCGAC  TCCAGCTACT ACAAAAATAT CCTTGTTCAC AAGGGCCTCT TCCATTCAGA CCAGGCGCTC CTGTCGAGTT CCAAGACCGC TAATCTGGTG AAGCAGAACG CGGCCAACGA GCACCTCTTC 
AAGAAGAGAT TTGCTGAGGC TATGGTGAAG ATGGGCAATA TCGAAGTGCT CACCGGGAAA AAAGGAGAGA TAAGATTGAA CTGTAGGGTG ATCAATTGA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGCCGGGGCCGAGGATAAGTGGGGAGATAGTGTTCTTGGCCCTGGTGCTTCTAATGTGTCTCAATGCTACGGCAGAATCTACGCTTCGAGTCGGTTATTACGAAAAGACATGTCCC
CAAGCAGAGTTTATCGTGAAGAAGGTTATAGCGAAGGCGACGAAGACGGACAATGGTCTACCCGCCGATTTCATCAGGATGCATTTTCACGACTGTTTCGTGAGG
GTGTGTTACGTAGCC
AGTTACGCCGATATTTATGTCTCTCGTCGAAAAGAAGATTATGCTCGATTACCGTAGCTCGTCAACGGCGGTTTATCTTCTTTCCTTCTGATGTTTTTAGGGTTGCGACGGATCAATTCT
TATCGACTCCACCTCGAACAACACCGCCGAGAAGGACTCACCCATCAACAACCCAAGCCTGGAAGGGTTCGAGATCATCGACGAGGCCAAGGCCAAGCTGGAGAAGAAGTGCAAGGGTGT
CGTGTCCTGCGCCGACATCCTCGCTTTTGCTGCCAGAGATAGTGTTGAGCTG
GTAGAATCAATGCCCTAATGTTCTTAACTTGATCGTATCACTTGCGTACACAAGACTTGGTGTCCCTG
TGGATGAGCATGGCTCTGCTCGGCTGACTTTGTTCGTGACTGCAGAGCGGAGGATTTTGGTACGAAGTCCCCTCGGGAAGGAGGGACGGAAGGATCTCCCGTAGTTCAGAGACATTCGGA
AACTTGGCGCCTCCGTCATTCAATTTATCACAGCTCACACAGAACTTTGCCAGCAAGGGTCTGAACCTGGACGACTTGGTCACCCTCTCTG
GTATGAAGAATATAAACGTTTAAAGAGAT
CTGTCAGTGGAACTTGAACACAATTGAACCCATATATTGTGATTCCTACGATTTTATTTTCTCATGCGGAACTATTCTTGTAATTTCAGGGGCGCACACCATCGGCAAGTCTCACTGCAC
CAGCATCAACAGTCGGCTGCACAACTTCAGTTCGACAGCCACCACCGATCCGAGCTTGGATCCGGCTTACGCGAAGAAATTGAAGAAGAAGTGTCCCAAAGGGAGCACCGACCCGAACCT
GACCGTCCCGATGGACCCTCCCAGTCCTGAGGTCTTCGACTCCAGCTACTACAAAAATATCCTTGTTCACAAGGGCCTCTTCCATTCAGACCAGGCGCTCCTGTCGAGTTCCAAGACCGC
TAATCTGGTGAAGCAGAACGCGGCCAACGAGCACCTCTTCAAGAAGAGATTTGCTGAGGCTATGGTGAAGATGGGCAATATCGAAGTGCTCACCGGGAAAAAAGGAGAGATAAGATTGAA
CTGTAGGGTGATCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGCCGGGGCCGAGGATAAGTGGGGAGATAGTGTTCTTGGCCCTGGTGCTTCTAATGTGTCTCAATGCTACGGCAGAATCTACGCTTCGAGTCGGTTATTACGAAAAGACATGTCCC
CAAGCAGAGTTTATCGTGAAGAAGGTTATAGCGAAGGCGACGAAGACGGACAATGGTCTACCCGCCGATTTCATCAGGATGCATTTTCACGACTGTTTCGTGAGG
GGTTGCGACGGATCA
ATTCTTATCGACTCCACCTCGAACAACACCGCCGAGAAGGACTCACCCATCAACAACCCAAGCCTGGAAGGGTTCGAGATCATCGACGAGGCCAAGGCCAAGCTGGAGAAGAAGTGCAAG
GGTGTCGTGTCCTGCGCCGACATCCTCGCTTTTGCTGCCAGAGATAGTGTTGAGCTG
AGCGGAGGATTTTGGTACGAAGTCCCCTCGGGAAGGAGGGACGGAAGGATCTCCCGTAGTTCA
GAGACATTCGGAAACTTGGCGCCTCCGTCATTCAATTTATCACAGCTCACACAGAACTTTGCCAGCAAGGGTCTGAACCTGGACGACTTGGTCACCCTCTCTG
GGGCGCACACCATCGGC
AAGTCTCACTGCACCAGCATCAACAGTCGGCTGCACAACTTCAGTTCGACAGCCACCACCGATCCGAGCTTGGATCCGGCTTACGCGAAGAAATTGAAGAAGAAGTGTCCCAAAGGGAGC
ACCGACCCGAACCTGACCGTCCCGATGGACCCTCCCAGTCCTGAGGTCTTCGACTCCAGCTACTACAAAAATATCCTTGTTCACAAGGGCCTCTTCCATTCAGACCAGGCGCTCCTGTCG
AGTTCCAAGACCGCTAATCTGGTGAAGCAGAACGCGGCCAACGAGCACCTCTTCAAGAAGAGATTTGCTGAGGCTATGGTGAAGATGGGCAATATCGAAGTGCTCACCGGGAAAAAAGGA
GAGATAAGATTGAACTGTAGGGTGATCAATTGA

Retrieve as FASTA