Entry information : SpolPrx38 ( Spipo6G0030400)
Entry ID 13241
Creation 2015-06-09 (Christophe Dunand)
Last sequence changes 2015-06-09 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-02-24 (Catherine Mathe)
Peroxidase information: SpolPrx38 ( Spipo6G0030400)
Name (synonym) SpolPrx38 ( Spipo6G0030400)
Class Class III peroxidase    [Orthogroup: Prx017]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Araceae Spirodela
Organism Spirodela polyrhiza (great duckweed)    [TaxId: 29656 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SpolPrx38
start..stop
S start..stop
SpolPrx17 453 2e-162 72..317 1..246
VvPrx28 452 3e-161 1..328 12..333
VvPrx27 452 4e-161 1..328 11..332
AcoPrx60 448 5e-160 4..328 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2758532..2758744 213 N° 2 2757632..2758411 780  
complement(join(2757632..2758411,2758532..2758744))


exon

Literature and cross-references SpolPrx38 ( Spipo6G0030400)
DNA ref. Phytozome 12:   pseudo6 (2758744..2757632)
Cluster/Prediction ref. Phytozome Gene 12:   31506040
Protein sequence: SpolPrx38 ( Spipo6G0030400)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (307)
PWM (Da):   %s   36194.23 (33771.0)  
PI (pH):   %s   8.96 (9.10) Peptide Signal:   %s   cut: 24 range:24-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEAMSVCLALVLSISLLVPSASASSLKVGFYKRTCPEAETIVRNIVGRAVHNNPGIGAGVIRMHFHDCFVRGCDGSVLLDSTPGKPAERQHPANNPSLRGFEVIDEAKAILESHCPNTVSCADVLAFAARDAAYFTGGFFYELPGGRRDGRVSLESEVPGNIPPPSFNAEQLKDNFARKGLSVDEMVTLSGAHSIGVSHCSSFSSRLYGFNSTHPQDPSMDPDLAEFLKSRCPRRRGNDRRDPTVPLDLATPHHLDIQYYRNLKKGRGLLTSDQTLWSSSRTAKLVAANTKNPHRWQEKYAAAMVHMGSIDVLTGRKGEIRRHCRVVNRH*

Retrieve as FASTA  
Remarks
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAGATTTTGA TCAAAGTACA CCCCGCTGGT GACAAATATG AGGTTAAGGT TTCTGTCGGT TGGTTCGACC GCTTTGACGA GCTCGAATCT TGCCCAGGAT TCCTGTATAG AAAGAGGGCT  TCCTTGTTCT TGTTGAGCGA TTACTATTAC TATTCACCGA AGGTAGCTCT GATTCCATTT ATTCTCATTA ATGCAGCCAA TAAAACGAGA TGAACGGTGT CCGTTGACAA CGGCGATGTG  ATCCGCAAAG CACTGTTGCT CAGACCGTTG AGAAAGTATC TCAATGGGCA GAAAGTTGTA AAAGAGGGAG ACGACGAGAG AGTTATTGCT CATGGGAGCA GCTCCCTCTC CACATTTCAA  TATTATTCTA TCACTAGATG TCTGGAGTCG TCGTCCTCTC TCGTGTCTCA TGGAATATGT CGATATGAAA AAGTCAACAA TATAGGTGTG TTGACGTACC ATCGTCTACA ATTTCCACAG  AGCACATATT TTCTGATCTC AACCAGCTAA TCTTTTACGA CGAGTTAGAC GGGTCAATTC TATCTAGCTT GGAATGCACT CAAACACGAC AATTTCCTTC AGGCTCCGGA TCTGCTTAAG  AATAAAAGTA TACCATATCA CAGTTTTTTC TCCCTGTAAT ATTGTATTTT ATATCTTAAT TTTCAGATTT GCATGCACAA CCGATTCGCT GTTTTATTGC ACAGACGACG AACGCCAGAA  CTCAGCAGGA GCTCTCCGTC CCCCAACAAG ATCGAGAGAG AGAGAGAGAG AGGAGGGAGG AGAGAGAGAG AGnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnAGAGAGA  GAGAGAGAGA GGCTCATTTT GACTACCGGC ACTTGCTTGT GATCTCCCAC CAGGGTCGTC CAAACGCGTG CTTGCGTTCG GCGCATGTCA ACGGGGAATT TACATTACTC GTACAGCTCT  GTCCGTGTCA TGGAATATGT CGACGTGAAA AAGTCAACAA TATAGGTGTG TTGATGTACT ATCGTCTACA ATTTCCACAG AGCAGGTATT TTGTTTTACG ACAATTTAGA TAGGTCAGTT  CTATGTAGCT TGGAACGCAC AGTTTAAACA AGACAAATTC CTTCCGGCTC CGGATCTGCT TTAGCATAAA GTACGACCGT ATCACAGTTT TTTCTCCACG GAATATTGTA TTTTATATTT  TAGTTTTCAG ATTTTCAGGC AATAGTGACC TCAACCATAA TAATGAAGAA AAATTACAGA ATATAGTCTA ATGTCTTAAC ACAATTTCTT ACATTTGTAT GAAAATTTAT GAATCACTCA  ACGGGAACGT GTTGCTGTTA ATCTTCTGTG TCGGGTTCTC TGCTGTCACA TTGCTGACGC AAATCTTAAA CCTCGTGGAC TGGGAACTTG AAAGCAGCTG CCAAGCGGAT TCACGTTCGA  GTAGTTCACG CATATTTTCC TTCTTGTGCT TTGTCTACCC TAAATTAAGC CTGTTTGTCG ATAGATAAAC TTATTGACAC CTTTAACCTA CATCATTCGG GCGGCTGTCC CGAAACTAGT  TTACGCTGAA GAATTCTCTC TCTTAGCCCC AGCCCCCACC TACCTCTCTC GCTTTCTCCA TCTGACTCGC TCTTCGTATT TTTTTTATAC AGAGAAGGTT GACTTATTCT ATATATCTTA  AATTACCAAT ACCGCGCGGG GTGTGAGGAC GCGGTCAGGA TGGAAGGCTC GGTCGTTGGG ATTAATAGAC AAGGTCCGCA AGCACGAGCA CTTCTTCCAG CCATCTCTTG CTTAAAAACA  CGGATAAGAA AAAGTCCACC CAATAGGGTG GAACATGTAT AAATATCCCA TCACGAGTGA AGGTGGCATC TCATCTGCAC CAGAGATATT CCATTCAGCT TCCGAGTTCC ATCTCCCACT  CTCTCTCCCT GTCGTTCCTC AATCGAACCT CTTGGAAACC AGTGCGGAAG ATAGAAATAC ACATGCGCAG AGGATACCAA ATGGAGGCCA TGAGTGTTTG CCTGGCACTC GTGCTGTCCA  TCTCTCTCCT AGTTCCCAGC GCATCCGCAA GTTCACTCAA AGTGGGATTC TACAAGCGGA CGTGCCCCGA AGCGGAAACA ATCGTCAGGA ACATCGTCGG CCGGGCCGTC CACAACAACC  CAGGCATAGG CGCCGGGGTC ATCAGGATGC ACTTCCACGA CTGCTTCGTC AGGGTGAGCT ACATCCCCTC CCCGCCGTCT TCTCGATTCG ACTGAACAGA AAAGAGAAAT CGAAGACGGT  AAACTGATCA CAAACAAGAG ATCTCATGAG GACTATTTTG GGCTTTTGAA CAGGGATGCG ATGGTTCGGT TCTCCTGGAC TCTACCCCCG GAAAACCCGC GGAGAGGCAG CATCCGGCGA  ACAACCCGAG CCTGCGCGGT TTCGAGGTGA TCGACGAAGC CAAGGCTATC CTGGAATCCC ACTGCCCCAA CACGGTGTCG TGCGCCGACG TCCTGGCCTT CGCAGCCCGC GATGCTGCGT  ACTTCACCGG CGGCTTCTTT TACGAACTTC CTGGCGGTAG GCGAGACGGG AGGGTGTCGT TGGAGTCTGA GGTCCCGGGC AATATTCCTC CACCCAGCTT CAACGCTGAG CAGCTCAAAG  ACAACTTCGC GAGGAAAGGG CTGTCGGTGG ACGAGATGGT GACTCTCTCC GGGGCCCATT CCATCGGCGT CTCCCACTGC TCGTCCTTCT CCAGCAGGCT GTACGGGTTC AACTCCACCC  ACCCACAGGA TCCCTCCATG GATCCCGACC TCGCGGAGTT CTTGAAGAGC AGGTGCCCGC GTCGGCGTGG CAACGACCGG CGCGACCCCA CTGTTCCCCT GGACCTGGCG ACGCCCCACC  ATCTGGATAT CCAGTACTAC AGAAACCTCA AGAAAGGGAG GGGTTTGTTG ACCTCCGACC AGACGCTGTG GAGCAGCTCC AGGACGGCAA AGTTGGTCGC GGCCAACACG AAGAATCCGC 
ACCGGTGGCA GGAGAAGTAC GCAGCCGCCA TGGTGCACAT GGGATCCATC GACGTGCTCA CCGGGCGTAA AGGCGAGATC AGGCGGCACT GTAGGGTCGT CAACCGCCAC TGA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCCATGAGTGTTTGCCTGGCACTCGTGCTGTCCATCTCTCTCCTAGTTCCCAGCGCATCCGCAAGTTCACTCAAAGTGGGATTCTACAAGCGGACGTGCCCCGAAGCGGAAACA
ATCGTCAGGAACATCGTCGGCCGGGCCGTCCACAACAACCCAGGCATAGGCGCCGGGGTCATCAGGATGCACTTCCACGACTGCTTCGTCAGG
GTGAGCTACATCCCCTCCCCGCCGTCT
TCTCGATTCGACTGAACAGAAAAGAGAAATCGAAGACGGTAAACTGATCACAAACAAGAGATCTCATGAGGACTATTTTGGGCTTTTGAACAGGGATGCGATGGTTCGGTTCTCCTGGAC
TCTACCCCCGGAAAACCCGCGGAGAGGCAGCATCCGGCGAACAACCCGAGCCTGCGCGGTTTCGAGGTGATCGACGAAGCCAAGGCTATCCTGGAATCCCACTGCCCCAACACGGTGTCG
TGCGCCGACGTCCTGGCCTTCGCAGCCCGCGATGCTGCGTACTTCACCGGCGGCTTCTTTTACGAACTTCCTGGCGGTAGGCGAGACGGGAGGGTGTCGTTGGAGTCTGAGGTCCCGGGC
AATATTCCTCCACCCAGCTTCAACGCTGAGCAGCTCAAAGACAACTTCGCGAGGAAAGGGCTGTCGGTGGACGAGATGGTGACTCTCTCCGGGGCCCATTCCATCGGCGTCTCCCACTGC
TCGTCCTTCTCCAGCAGGCTGTACGGGTTCAACTCCACCCACCCACAGGATCCCTCCATGGATCCCGACCTCGCGGAGTTCTTGAAGAGCAGGTGCCCGCGTCGGCGTGGCAACGACCGG
CGCGACCCCACTGTTCCCCTGGACCTGGCGACGCCCCACCATCTGGATATCCAGTACTACAGAAACCTCAAGAAAGGGAGGGGTTTGTTGACCTCCGACCAGACGCTGTGGAGCAGCTCC
AGGACGGCAAAGTTGGTCGCGGCCAACACGAAGAATCCGCACCGGTGGCAGGAGAAGTACGCAGCCGCCATGGTGCACATGGGATCCATCGACGTGCTCACCGGGCGTAAAGGCGAGATC
AGGCGGCACTGTAGGGTCGTCAACCGCCACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCCATGAGTGTTTGCCTGGCACTCGTGCTGTCCATCTCTCTCCTAGTTCCCAGCGCATCCGCAAGTTCACTCAAAGTGGGATTCTACAAGCGGACGTGCCCCGAAGCGGAAACA
ATCGTCAGGAACATCGTCGGCCGGGCCGTCCACAACAACCCAGGCATAGGCGCCGGGGTCATCAGGATGCACTTCCACGACTGCTTCGTCAGG
GGATGCGATGGTTCGGTTCTCCTGGAC
TCTACCCCCGGAAAACCCGCGGAGAGGCAGCATCCGGCGAACAACCCGAGCCTGCGCGGTTTCGAGGTGATCGACGAAGCCAAGGCTATCCTGGAATCCCACTGCCCCAACACGGTGTCG
TGCGCCGACGTCCTGGCCTTCGCAGCCCGCGATGCTGCGTACTTCACCGGCGGCTTCTTTTACGAACTTCCTGGCGGTAGGCGAGACGGGAGGGTGTCGTTGGAGTCTGAGGTCCCGGGC
AATATTCCTCCACCCAGCTTCAACGCTGAGCAGCTCAAAGACAACTTCGCGAGGAAAGGGCTGTCGGTGGACGAGATGGTGACTCTCTCCGGGGCCCATTCCATCGGCGTCTCCCACTGC
TCGTCCTTCTCCAGCAGGCTGTACGGGTTCAACTCCACCCACCCACAGGATCCCTCCATGGATCCCGACCTCGCGGAGTTCTTGAAGAGCAGGTGCCCGCGTCGGCGTGGCAACGACCGG
CGCGACCCCACTGTTCCCCTGGACCTGGCGACGCCCCACCATCTGGATATCCAGTACTACAGAAACCTCAAGAAAGGGAGGGGTTTGTTGACCTCCGACCAGACGCTGTGGAGCAGCTCC
AGGACGGCAAAGTTGGTCGCGGCCAACACGAAGAATCCGCACCGGTGGCAGGAGAAGTACGCAGCCGCCATGGTGCACATGGGATCCATCGACGTGCTCACCGGGCGTAAAGGCGAGATC
AGGCGGCACTGTAGGGTCGTCAACCGCCACTGA

Retrieve as FASTA