Entry information : SpolKat02 ( Spipo17G0032400)
Entry ID 13254
Creation 2015-06-19 (Christophe Dunand)
Last sequence changes 2015-06-19 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-02-24 (Catherine Mathe)
Peroxidase information: SpolKat02 ( Spipo17G0032400)
Name (synonym) SpolKat02 ( Spipo17G0032400)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Araceae Spirodela
Organism Spirodela polyrhiza (great duckweed)    [TaxId: 29656 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SpolKat02
start..stop
S start..stop
GhKat01 824 0 1..420 1..420
VvKat02 819 0 1..420 1..420
ZaKat01 818 0 1..423 1..423
LuKat 817 0 1..420 1..420
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2403345..2403359 15 N° 2 2402830..2402926 97 N° 3 2401522..2401799 278 N° 4 2400209..2400985 777
N° 5 2400009..2400116 108  
complement(join(2400009..2400116,2400209..2400985,2401522..2401799,2402830..2402 926,2403345..2403359))


exon

Literature and cross-references SpolKat02 ( Spipo17G0032400)
DNA ref. Phytozome 12:   pseudo17 (2403359..2400009)
Cluster/Prediction ref. Phytozome Gene 12:   31514501
Protein sequence: SpolKat02 ( Spipo17G0032400)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   425
PWM (Da):   %s   48632.13  
PI (pH):   %s   6.65
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYRHRPSSANNSSFWTTNSGAPVWNNDSSLTVGPRGPILLEDYHLIEKLAQFDRERIPERVVHARGASAKGFFEVTHDISHLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTREGNFDLVGNNFPVFFIRDGMKFPDMVHALKPNPKSHIQENWRILDFFSHHPESLHMFTFLFDDLGIPADYRHMEGSGVNTYTLISKEGKALYVKFHWKPTCGVKCLLDDEAVSVGGSNHSHATQDLYDSIAAGNYPEWKLYIQTIDPDHEDRFDFDPLDVTKTWPEDILPLQPVGRLVLNKNIDNFFSENEQLAFCPAIVVPGIHYSDDKLLQTRVFSYADTQRHRLGPNYLMLPPNAPKCAHHNNHHEGSMNFMHRDEEVNYFPSRYDPVRHAEQFPIPPRVLTGRREKVGFQL*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACCCCTACAGGGTGATCTCCTCTCCCTCTCTCGTTCCTGGTGATGTCTGTTGCTCACGTTATGTTTTGCCGCTCGTGGAATTCTAGGTCGAGTGTTTTGCTTTTTGATCTTCCGCA
AGTTATCTATCCCTTCCGGGGAGGGATGATATAGGATCAATCCCTTCGTCGCATCGATTAGGCCATTTCTCTTTCCGGTCTTGTTCTCTCGGGGATAGTTAATCCCGCTGAAATAGTTTT
TCTTCCGGATCAGATTTTGGGGGATTATTTAGCCGTTGTTGAAGATATTTTTACTTCGTCCGTTGTGTAATTCGAGTATTACTCAACATTGTTTCATCTCGCCGATTGAGATGCTTCTAT
TTGTTCTACGGGTGGTTCGTGTTACTACTACTTATTTTCCTCACCATTATTTGTTAACGTTGGTTTGTTGCAGCACCGTCCTTCGAGCGCCAACAACTCTTCCTTCTGGACGACCAATTC
CGGGGCGCCCGTTTGGAACAACGACTCCTCCCTCACTGTCGGCCCTCGGG
GTACTGTCTCATCTCTTACTGCTCTGTAGTCGTCAATTTTTTCTCGTCTCCCTTTTAATCTACTCCATGG
AGGCCAGCTCGTGCATGGGCCCTCGGGTGTTTCGAGTTGATTTTTTTTGGTCTCCCACTCATCGTCGTCTTTTTCTCATTCGGTTGGCTTCAACCTTTTTTTTCCGTCTTCTTTTGGACT
AACTTGCCTCTGTTGATTGATCTTTACTGCAAATGGACTTTTTTTTTATGCCCACATTGTAAGAAAAATCAAGGCCGTTCCTTTTGATTATGTGCCCTTATTGATATGCATACTAACGGT
AAAATGTGCTATGTATATATAAAAAAAAACCGGACTAGAAATAATTATCCCCAAGGAAATTAGTGCTTAGGCATGCAGCTTGAAAAATATTCCTGGCTTATGCAATACCTTTAAGGCCTC
TGTGGTATCCGTCTATCTGATTCAATAATCCCCGTTATTTTTTTTAATTTTCTTTTTAAGGAAATAGTGGCAATGTGACTTTTCAATCGGATATGATAGAATAAGACATCTCAGTTTGGA
ACTATTGACCGGTCTCTGGAAGTAGACCTAACACCATCTATTTTGTTTCCTTGGGTTCTTTCACTACTATCCTTTACCTTGATTGGATATCGATGTTAGAAGAGTTTCATTTGCCATCTG
TTAGGTCCTCAAAGAAGCTAAATAACAAGTTTTCACTGAATTTCACGAGAAAACTATTCTTCTAGTTCACTTTCGTTTGTGCTTCTTTTGGTGCATCTCTAAAATTTTATATTCGGATCC
ATATTTTCTTTTTTATTGAGTGGAAAACTTAGTATATACCTCTCTTGTGACTTATAGAAAGTCTGATCCTTTGTTGCTTGAAAATGAGTTTGCTTTGGTAAATATAACATTTTTTCCGTT
TTATTATGACATTTATTTAGGAAATGATTACTTTCGTCGTCTTGATTATATGCAATAAAGCTGTTTTCCTTGCCTAGGAATGTTCCGAAGGGTAATTATTCAGTCCATTTTGATGGTCAG

GACCAATACTGCTGGAGGATTACCATCTCATCGAGAAACTTGCGCAGTTTGATAGGGAACGCATCCCTGAACGCGTCGTCCATGCTAGGGGAGCGAGTGCCAAGGGTTTCTTTGAGGTCA
CTCATGATATTTCTCATCTCACCTGTGCTGACTTTTTGCGGGCACCGGGAGTCCAGACCCCTGTGATTGTCCGTTTCTCAACTGTTATTCACGAGAGGGGAAGCCCCGAGACTCTAAGAG
ACCCTAGGGGTTTTGCTGTCAAGTTCTACACTAGAGAG
GTATTGAGGACCTTCTTCTTCTTCCTCTTCTTCCTCTTCTTCTACACTAAAGATGGCTCCATAGGGATTAATAGGAGATGTT
TAATGAGAAAATCAGTAACTGATTCAATGGATGAAGCCAGTGCTTGTCCTGAGTAATATCCCATGGATATTACTTAGGATGAAATGAGCTCCATCGTTGACCTTCCCGTCGCCACTCATG
TTATCTTGAATGCTAAGCTAATGAGGCACCCCTGTCTCATCTGGCTAGATTATTAGAAACCTAGCCTTCCAGCTTCATAATGTTCTATCTGTTTTTTGTTTCAGAATCATGCTGAGAATA
TTTTGAAATCAGTTTCCGATTAGACTGCAGTCCGAAAAACCTTCAGCTTAAAAGAAACAAAATGATGGAAATTTAGATTATTGTACAATATAAGCACAATAATCTAAATTTCCATCTGAT
AATGCATGCTCTCACACGCAGGATGCCACTCTGAAGTGGCACGAGTTGTGCTTCGAGCTCGCGGATCTTAATGGTGCTTTTCTCTTGTTCTCAGGGGAATTTTGATCTGGTGGGGAATAA
TTTCCCGGTATTCTTCATCCGGGATGGGATGAAGTTCCCTGACATGGTCCACGCCCTCAAGCCCAACCCCAAGTCGCACATCCAAGAGAACTGGAGGATCCTCGACTTCTTCTCCCACCA
CCCGGAGAGCCTGCACATGTTCACCTTCCTCTTCGACGACCTCGGCATCCCCGCTGACTACAGGCACATGGAAGGCTCCGGGGTCAACACCTACACTCTAATCAGCAAGGAAGGGAAGGC
TCTCTATGTGAAGTTCCACTGGAAGCCCACCTGCGGCGTGAAGTGCCTGCTGGACGACGAGGCGGTCTCGGTCGGCGGCAGCAACCACAGCCACGCCACCCAGGACCTCTATGACTCCAT
CGCCGCGGGCAACTACCCTGAATGGAAGCTCTACATCCAGACGATAGACCCCGACCACGAGGACCGGTTTGACTTCGACCCACTCGACGTCACCAAGACCTGGCCCGAGGACATCCTGCC
GCTGCAGCCGGTCGGCCGCCTGGTGCTGAACAAGAACATCGACAACTTCTTCTCTGAGAACGAGCAGCTCGCCTTCTGCCCGGCCATCGTCGTGCCGGGGATCCACTACTCGGACGACAA
GCTGCTCCAGACCAGGGTCTTCTCCTACGCCGACACCCAGCGGCACCGCCTCGGGCCGAACTACTTGATGCTCCCGCCAAACGCCCCCAAGTGCGCCCACCACAACAACCACCACGAGGG
GTCGATGAATTTCATGCACAGGGACGAGGAG
GTAATATTTCTGCGTTCTGTCCACATGTTTTTTTGTCAAGATCAGTCGTCCCATGCTGGTTATTATTTTTCTGACCATGCTGTGCTACT
CAGGTGAATTACTTCCCTTCGAGGTACGACCCGGTGCGTCACGCCGAGCAGTTCCCCATTCCGCCCCGGGTTCTCACGGGGAGGCGCGAGAAGGTGGGTTTTCAGCTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACCCCTACAGGCACCGTCCTTCGAGCGCCAACAACTCTTCCTTCTGGACGACCAATTCCGGGGCGCCCGTTTGGAACAACGACTCCTCCCTCACTGTCGGCCCTCGGGGACCAATA
CTGCTGGAGGATTACCATCTCATCGAGAAACTTGCGCAGTTTGATAGGGAACGCATCCCTGAACGCGTCGTCCATGCTAGGGGAGCGAGTGCCAAGGGTTTCTTTGAGGTCACTCATGAT
ATTTCTCATCTCACCTGTGCTGACTTTTTGCGGGCACCGGGAGTCCAGACCCCTGTGATTGTCCGTTTCTCAACTGTTATTCACGAGAGGGGAAGCCCCGAGACTCTAAGAGACCCTAGG
GGTTTTGCTGTCAAGTTCTACACTAGAGAG
GGGAATTTTGATCTGGTGGGGAATAATTTCCCGGTATTCTTCATCCGGGATGGGATGAAGTTCCCTGACATGGTCCACGCCCTCAAGCCC
AACCCCAAGTCGCACATCCAAGAGAACTGGAGGATCCTCGACTTCTTCTCCCACCACCCGGAGAGCCTGCACATGTTCACCTTCCTCTTCGACGACCTCGGCATCCCCGCTGACTACAGG
CACATGGAAGGCTCCGGGGTCAACACCTACACTCTAATCAGCAAGGAAGGGAAGGCTCTCTATGTGAAGTTCCACTGGAAGCCCACCTGCGGCGTGAAGTGCCTGCTGGACGACGAGGCG
GTCTCGGTCGGCGGCAGCAACCACAGCCACGCCACCCAGGACCTCTATGACTCCATCGCCGCGGGCAACTACCCTGAATGGAAGCTCTACATCCAGACGATAGACCCCGACCACGAGGAC
CGGTTTGACTTCGACCCACTCGACGTCACCAAGACCTGGCCCGAGGACATCCTGCCGCTGCAGCCGGTCGGCCGCCTGGTGCTGAACAAGAACATCGACAACTTCTTCTCTGAGAACGAG
CAGCTCGCCTTCTGCCCGGCCATCGTCGTGCCGGGGATCCACTACTCGGACGACAAGCTGCTCCAGACCAGGGTCTTCTCCTACGCCGACACCCAGCGGCACCGCCTCGGGCCGAACTAC
TTGATGCTCCCGCCAAACGCCCCCAAGTGCGCCCACCACAACAACCACCACGAGGGGTCGATGAATTTCATGCACAGGGACGAGGAG
GTGAATTACTTCCCTTCGAGGTACGACCCGGTG
CGTCACGCCGAGCAGTTCCCCATTCCGCCCCGGGTTCTCACGGGGAGGCGCGAGAAGGTGGGTTTTCAGCTGTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACCCCT ACAGGCACCG TCCTTCGAGC GCCAACAACT CTTCCTTCTG GACGACCAAT TCCGGGGCGC CCGTTTGGAA CAACGACTCC TCCCTCACTG TCGGCCCTCG GGGACCAATA  CTGCTGGAGG ATTACCATCT CATCGAGAAA CTTGCGCAGT TTGATAGGGA ACGCATCCCT GAACGCGTCG TCCATGCTAG GGGAGCGAGT GCCAAGGGTT TCTTTGAGGT CACTCATGAT  ATTTCTCATC TCACCTGTGC TGACTTTTTG CGGGCACCGG GAGTCCAGAC CCCTGTGATT GTCCGTTTCT CAACTGTTAT TCACGAGAGG GGAAGCCCCG AGACTCTAAG AGACCCTAGG  GGTTTTGCTG TCAAGTTCTA CACTAGAGAG GGGAATTTTG ATCTGGTGGG GAATAATTTC CCGGTATTCT TCATCCGGGA TGGGATGAAG TTCCCTGACA TGGTCCACGC CCTCAAGCCC  AACCCCAAGT CGCACATCCA AGAGAACTGG AGGATCCTCG ACTTCTTCTC CCACCACCCG GAGAGCCTGC ACATGTTCAC CTTCCTCTTC GACGACCTCG GCATCCCCGC TGACTACAGG  CACATGGAAG GCTCCGGGGT CAACACCTAC ACTCTAATCA GCAAGGAAGG GAAGGCTCTC TATGTGAAGT TCCACTGGAA GCCCACCTGC GGCGTGAAGT GCCTGCTGGA CGACGAGGCG  GTCTCGGTCG GCGGCAGCAA CCACAGCCAC GCCACCCAGG ACCTCTATGA CTCCATCGCC GCGGGCAACT ACCCTGAATG GAAGCTCTAC ATCCAGACGA TAGACCCCGA CCACGAGGAC  CGGTTTGACT TCGACCCACT CGACGTCACC AAGACCTGGC CCGAGGACAT CCTGCCGCTG CAGCCGGTCG GCCGCCTGGT GCTGAACAAG AACATCGACA ACTTCTTCTC TGAGAACGAG  CAGCTCGCCT TCTGCCCGGC CATCGTCGTG CCGGGGATCC ACTACTCGGA CGACAAGCTG CTCCAGACCA GGGTCTTCTC CTACGCCGAC ACCCAGCGGC ACCGCCTCGG GCCGAACTAC  TTGATGCTCC CGCCAAACGC CCCCAAGTGC GCCCACCACA ACAACCACCA CGAGGGGTCG ATGAATTTCA TGCACAGGGA CGAGGAGGTG AATTACTTCC CTTCGAGGTA CGACCCGGTG 
CGTCACGCCG AGCAGTTCCC CATTCCGCCC CGGGTTCTCA CGGGGAGGCG CGAGAAGGTG GGTTTTCAGC TGTAA 

Retrieve as FASTA