Entry information : GmarCIIBB06
Entry ID 13287
Creation 2015-06-30 (Christophe Dunand)
Last sequence changes 2017-04-26 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-05-10 (Catherine )
Peroxidase information: GmarCIIBB06
Name GmarCIIBB06
Class Other class II peroxidase type B    [Orthogroup: CIIBB002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarCIIBB06
start..stop
S start..stop
HsubCIIBB08 542 0 1..357 1..358
GmarCIIBB02 540 0 1..357 1..352
GmarCIIBB01 539 0 1..357 1..352
HsubCIIBB04 538 0 1..357 1..359
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 723192..723249 58 N° 2 723014..723141 128 N° 3 722908..722966 59 N° 4 722713..722853 141
N° 5 722417..722662 246 N° 6 722332..722366 35 N° 7 722239..722284 46 N° 8 722116..722185 70
N° 9 722012..722057 46 N° 10 721878..721954 77 N° 11 721724..721822 99 N° 12 721634..721673 40
N° 13 721498..721577 80  
complement(join(721498..721577,721634..721673,721724..721822,721878..721954,7220 12..722057,722116..722185,722239..722284,722332..722366,722417..722662,722713..7 22853,722908..722966,723014..723141,723192..723249))


exon

Literature and cross-references GmarCIIBB06
DNA ref. JGI genome:   scaffold_20 (723249..721497)
Cluster/Prediction ref. JGI gene:   101039
Protein sequence: GmarCIIBB06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   374 (354)
PWM (Da):   %s   39428.97 (37183.7)  
PI (pH):   %s   4.7 (4.61) Peptide Signal:   %s   cut: 21 range:21-374
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFRNALSAFVFALPLLANGLRTKRATCPDGIHTAINAQCCSLFPVVDDLVENLFEGECGDAHGALRLLFHDAIGISTTAGGGGADGSIAVFNETELTFHANTGIDDVFDALGPFLQKHSNVLSPGDFIQLAGAVSLVQCPGAPRIQFFKGRAQPKAASPPNLVPEPFDSVQSILARFQPLGFTVPEIVAIIGGSHSIAGADDIVPNQQGVPFDQTPDVFSQIFVDVQLRGTLFTGQGGQQGEVQSAVQGLVRLQSDHLARDSATNCEWQSNVNNHAKLVSNFASGVQKLALLGQVKSLTDCSEVIPAAIPFSGASPTLPPGLKMTDIEQACATASFPILPTQPGPPTTVPQMCAVFLTPYLCFFLKNFL

Retrieve as FASTA  
Remarks Complete sequence from genomics (12 introns). Incorrect prediction from JGI (two ORF have been fused).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAGAAACGCCCTCTCTGCCTTCGTCTTCGCACTTCCCCTTCTCGCCAATGGTTCGTATGTTACCATCGTCGACAGTAACATGTGCTCATCACTATCGCAGGCTTAAGAACCA
AGCGGGCCACTTGTCCTGATGGAATTCACACCGCAATAAACGCCCAATGTTGCTCCCTGTTCCCCGTCGTCGACGACCTCGTAGAGAACCTTTTCGAGGGCGAGTGCGGTGATGGA
GTCA
GTTCTTTCTTTCCTTTAAAATTGCAGGTCCTTACTATCTATAGGCTCACGGTGCACTTCGTCTCCTGTTCCACGATGCCATTGGAATCTCTACGACAGCAGGGTATGTCCACTTAAAAAT
TGACATATTTGCATATTCTCATCCACCAATAAACAGTGGCGGAGGAGCGGATGGGTCGATCGCTGTTTTCAACGAAACAGAGCTCACTTTCCACGCCAACACTGGTATTGACGATGTATT
TGATGCTCTTGGGCCGTTCCTTCAGAAGCATTCCAACGTTCTGAGTCCCGGAGACTT
GTATGTCAATTTAATGTTCAATAAGACCTCATTTCATCATTTCCCAATAGCATTCAACTTGCT
GGTGCGGTCAGCCTTGTTCAATGCCCCGGTGCACCTCGTATACAATTCTTCAAGGGGCGTGCGCAGCCTAAAGCAGCATCACCTCCTAATCTTGTGCCGGAGCCATTCGATAGTGTTCAG
AGTATTCTTGCACGCTTCCAGCCACTCGGCTTCACGGTCCCAGAAATTGTAGCGATCATTGGCGGATCTCATAGTATCGCTGGAGCTGATGACATTGTACCAAACCAGCAGGG
GTAAGCC
TTGTCGCGGTAGGCAATTCAAAATGATGCTAACTAGCTTTCAGAGTGCCATTCGATCAGACACCTGACGTATTTGACTGTGAGTTCTCTTAAAATACGGATCTTCAAAAGCTGAACTATT
CATAGCTCAAATCTTCGTCGACGTGCAACTTCGCGGCACCTTGTTTACCGGGTTCGTATCATAACCATCCGATTACAAACTTGCTCTCAAGGTTTTATAATTAGGCAAGGAGGTCAACAA
GGAGAGGTCCAATCTGCTGTTCAAGGTTTAGTCCGTTTGCAATCGGATCATCTC
GTAAGTCATATTCGAGTGAAAGTATTTCATATAACAACCAATCTTCTCATCCTCACAGCTTGCTCG
TGACTCTGCGACTAACTGCGAGTGGCAATCGAACGTTA
GTACGTAACCGATCTCTTTTGCTGCTTCCATACTCTGATTAGAACTGAACTCTCAAGACAACCACGCCAAACTGGTCTCCAA
CTTTGCTTCAGGCGTTCAAAAGCTTGCTCTCTTGGGTCAGGTCAAATCTCAG
GTTAGTACATAAGGGTACAAAATATTATTTCGTCATAGATACTAATACTGCGTAGTTGACCGACTGTA
GTGAAGTTATTCCAGCAGCGATTCCCTTCAGCGGTGCCTCACCGACCCTCCCCCCTGGACTCAAGATGACCGATATTGAGCAGGCT
GTGAGTAATATTTCTACTTCATATGAAGTCTGAT
TATAAACTTCGACTAGTGCGCCACCGCGTCATTCCCAATCCTTCCTACTCAACCAGGTATGTGCTTCAAATATTCAATTCAGGTCCATCTTATAGAGAAATTATCCATAAAGGTCCCCCT
ACAACTGTCCCACAAATGTGCGCTGTTTTTCTAACTCCTTACCTCTGCTTCTTCCTAAAAAATTTCTTATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAGAAACGCCCTCTCTGCCTTCGTCTTCGCACTTCCCCTTCTCGCCAATGGCTTAAGAACCAAGCGGGCCACTTGTCCTGATGGAATTCACACCGCAATAAACGCCCAATGT
TGCTCCCTGTTCCCCGTCGTCGACGACCTCGTAGAGAACCTTTTCGAGGGCGAGTGCGGTGATGGA
GCTCACGGTGCACTTCGTCTCCTGTTCCACGATGCCATTGGAATCTCTACGACA
GCAGG
TGGCGGAGGAGCGGATGGGTCGATCGCTGTTTTCAACGAAACAGAGCTCACTTTCCACGCCAACACTGGTATTGACGATGTATTTGATGCTCTTGGGCCGTTCCTTCAGAAGCAT
TCCAACGTTCTGAGTCCCGGAGACTT
CATTCAACTTGCTGGTGCGGTCAGCCTTGTTCAATGCCCCGGTGCACCTCGTATACAATTCTTCAAGGGGCGTGCGCAGCCTAAAGCAGCATCA
CCTCCTAATCTTGTGCCGGAGCCATTCGATAGTGTTCAGAGTATTCTTGCACGCTTCCAGCCACTCGGCTTCACGGTCCCAGAAATTGTAGCGATCATTGGCGGATCTCATAGTATCGCT
GGAGCTGATGACATTGTACCAAACCAGCAGGG
AGTGCCATTCGATCAGACACCTGACGTATTTGACTCTCAAATCTTCGTCGACGTGCAACTTCGCGGCACCTTGTTTACCGGGCAAGGA
GGTCAACAAGGAGAGGTCCAATCTGCTGTTCAAGGTTTAGTCCGTTTGCAATCGGATCATCTC
CTTGCTCGTGACTCTGCGACTAACTGCGAGTGGCAATCGAACGTTAACAACCACGCC
AAACTGGTCTCCAACTTTGCTTCAGGCGTTCAAAAGCTTGCTCTCTTGGGTCAGGTCAAATCTCAG
TTGACCGACTGTAGTGAAGTTATTCCAGCAGCGATTCCCTTCAGCGGTGCCTCA
CCGACCCTCCCCCCTGGACTCAAGATGACCGATATTGAGCAGGCT
TGCGCCACCGCGTCATTCCCAATCCTTCCTACTCAACCAGGTCCCCCTACAACTGTCCCACAAATGTGCGCTGTT
TTTCTAACTCCTTACCTCTGCTTCTTCCTAAAAAATTTCTTATAG

Retrieve as FASTA