Entry information : EsilAPx02 ( Esi_0438_0006)
Entry ID 13390
Creation 2014-11-19 (Bruno Savelli)
Last sequence changes 2015-08-05 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-10 (Achraf Jemmat)
Peroxidase information: EsilAPx02 ( Esi_0438_0006)
Name (synonym) EsilAPx02 ( Esi_0438_0006)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EsilAPx02
start..stop
S start..stop
EsilAPx01 451 6e-161 90..378 3..291
GtAPx02 402 3e-140 57..378 24..364
EsilAPx03 390 9e-137 106..378 3..276
PtrAPx01 338 1e-115 84..371 29..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 36718..36724 7 N° 2 33129..33397 269 N° 3 31313..31409 97 N° 4 31094..31130 37
N° 5 29814..29983 170 N° 6 29242..29360 119 N° 7 28605..28697 93 N° 8 27620..27753 134
N° 9 26722..26869 148 N° 10 25750..25812 63  
complement(join(25750..25812,26722..26869,27620..27753,28605..28697,29242..29360 ,29814..29983,31094..31130,31313..31409,33129..33397,36718..36724))


exon

Literature and cross-references EsilAPx02 ( Esi_0438_0006)
Literature Cock,J.M. et al.? The Ectocarpus genome and the independent evolution of multicellularity in brown algae. Nature 465 (7298), 617-621 (2010)
Protein ref. UniProtKB:   D7G168
DNA ref. GenBank:   FN648639.1 (36724..25750)
EST ref. GenBank:   FP264545.1 [3' end]   FP270990.1 [Fragment]
Protein sequence: EsilAPx02 ( Esi_0438_0006)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   378
PWM (Da):   %s   40596.13  
PI (pH):   %s   6.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPALLRASSRREQQANTLRAAYLPWTSKQQSSSRMKAFAACVTAVAALDCASAFVAPVVTSSFASSSLSRTSARSRAPGVLRMSSAVSTDAVAALQECKKELAGMIDKTNSHPIMIRLAWHDAGTYNKDSTEGWPRQGGANGSIRFEPEINHGANAGLTTALKLLTPIKKKFEEVGWADLMQLASATAVEVGGPAIDMKYGRKDAVAPEDCVDEGSLPAGNKPFPDADNADHLRNVFYRMGFGDEGIVALSGAHTLGRAFKDRSGEGAESTKFTSGDHVARGDGKAGYGRKGGSSWTEKWLKFDNSYYATVPDEASDPELLKLGTDKSLFDDEGFLPFAQKYRDSEEAFFEDYKAHKQLAELGVEWEVEGGISI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns) and 4 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAGGCAATGCCCCTCATGAAACCACCTGGGGCTGGGCTGCTATTGCGGCGGCGTGAACCTCCTGCTTGAAGCAAACGACCTCATCATCAACCAGAGCGCCGGTTGTGTTTTGGCAT
CATCATCATCATCATGACCGACCACGAAGCAACGGACATGGGATAAGGGCGTGGTGGCGACGGCTGGCTGTGTAAAACACGTTGCTGAGCACTGGCGGCGGTAAAGCTAGGAGGAGAGGC
AGAGGTAGCAGCGGTCACCCCGTTTCGGCTTTTCCAGGTGAATATGTTGGTGCTACAAGCAAGTGTACAGCAACAGCAGTGAGTTGCAGCGCTTAGCCTTCGTGGGGTGTATCGTGTGCG
TGCCTCTCTGTACGCTGCTTAGTACCCCATTGATGTGACGGCTGCTGCTGTACTGCTGTAGTGTGCGTACATAACGGGTACCGAACGTTTCTTTATTAACAGATCAGCAGGTGCTGTCCT
GCAACGTCGTCACGAAATCAATCGGTCTTTTCTCGCAAGCATTATTTCACCACAGCGCAGCAACTTTACAGCAGTGTAGCAGATAGAGTCGATGACCGTCAGCAGTGCCGGCCCGCTCGT
AAGAGCTTGGGCGAGGTTAAGCACCTTGCCGCAGCCATGTGAGCTGTGTATCATATCCTCTTACTTTATTTTTGCCAGCTAGTACAGCGAAGACAGCACAGCAGATAGAGTTCATGCCCA
CCCCCTTTGAACACCAAGCTTTCATCCCAGTATGTCTAGTCTACCTCAGAAGAAGGCATTACAAGACCGTCTGCAAGCACCTTACAGTAGGTTACCGTTCCCAAATGAGAACCCACACGA
TCTATCGTATGCATATTTATCCTCATCCTCAGTCGCTGTTTCAAACGTTGAGAATCCGCGCATGTTTCCGTGCCGGGGTGCCGCTCATCGCAACCGTCGATCCGCTCGGTCAACGCCTAT
TCTCCCACGGCTGATTTCGCCTCGTCTACACTGCTCGCATCTAGAGGCAACGTCACGCTAATAGTCCTTTGATGGGGCGTCAATGCCACGCCGTATGCATACGTCGTCGTACATGTGGCT
GTTCAGGGCAGCCACCTGATTGATCTGCCCCAATAACTACCCCCGAACCAAGCCTCAAGAACATACAAACAACCAATACAAAGCGCAACCTAGCTCGTGAGGGGGGACCCCCGAAGACGA
AATCCGTCCGGAAGCTGCATCGCTGCATGTATCAAGCTGTGACTAGGGGTCAAAGGCCGTTTCTTCCCACGTCCAACCTCAAATCCTTTCATTTGTAGCAACTGTATCCACGCAGTCCCT
TCCGAGGAACTGGAGATCTGTGAAGGTCTGCTTGCTGTACGTCGGCAACCTTGTCACGGTTCTTTCTTTTTTGTCGTCAACGTTCAACTGCAACCTTCAGCAGTATGTAGCGGGTTGTTT
GTTCTTACCTCCTGTGTACCGCAGTTTTATGTACATAGCGCGAGTGTAATTCCTACTTGTACAGCAGTAGTTTCAGGGTTTATCATCGGTAACGCTCGTTGAGGCGGACACAGGGTGCAG
GCTTGTATGGTAGTAAATACGTGGTACATCGTTGAGGCGTGTCAATGCAGTTGCTGACGTTTTCCCTCCTGTGTGTTCTTCGTACCCCTTTCCTCCTCTTGCTCCATCCGTGCATCAGGT
ACTCTCGCTCAGCATCCTAACGGCACCGCGGCGCTGGCGGGAAGCCGGCCGCGACTCGAGCCTCACTTGACAAGCCGGTTCATCTTTAGGTGGGTCATATGCATAGAGCAGCAACAGGGG
GTTTCGTGCAGTCCAGATTGCGATACAACTCTACGGATGAGCGTGATATTGTTGAGGGATACGCTTGCATGCGTGCTGCTGGGAGCGACATTTGTGCTACTCAAGTGTTTGTAGAGTTTC
TGCATTTTTGTTTACGACGCATACTTGTATCGATGGCACAACGGCCGGGCACACTTTTACCAACTGTCCGCGGTCCAACCATGGCACTACAAAGGGCCGTAGAGAAGTTCGACGCTTGGG
TATGTTCACTTTTGCCTTTTGGCCTCTGATGAAAATGCTGAATCGCAAAACACATGTCATGTTCTCGCTTTGGATGACAGGTGTTCATACAACCGAGCGCTGGACATCAAGACGGGGTCG
AAGGCTGATTTGGCGGTTCCTCTCCGTCGAACAGCTACCCAACCTATGGGGTGCCAGGGCAGTGTTTGAAGACGTGGTGTTAATCCTGCGCGATGTAACGGCGATTCAATGCGAACCTCT
TGGTGATCATTGGCAGTCATCTTGCATCCTGCGGAGAACTGTTGTGACGACCGGAAGATGTAAACGCTTGGTTTACGCACAGGCACATTCGGAGATCTAGGGTTCGTTTTCCATGCTTAT
TCGTTGCTATTTCAGCGAGCGCCTATTCGGCGAGCAAATGCTGTTGTGTCCCGTTGGAATTTGGAAACGCCTTGTGTATAGGTTACAGCGGTAGCAGCCGGTGACTGGGGTAGTGAGTAG
GGGCGGTTTGGTGGGGACGGGGGCGTCCATGCCGAATGCGAAGATGGGCATGAGGGGATAGAAGTACCATCCGTGCTATGGAGGCTGGACATGTGTCATTTTTCGGGGGGGCGTGCAAAC
CTTGTGGGCACCACAACAGCAGTAGGAGTGCCTGGCAGCAACGTAAGTACATAGCAGTAATGGGAGAGAACTACATAGTGTTGGCAAACTCTGCTGTCGCTGAAGTTCCAATTCTTGTTT
CCCAAACCGGTTTGGGGGTAAACGGCAACGGCCGATGCTAGCCCTGATCGGGGTGTGGTGCAGTCTTCTGTAGCAGAACCAACCTACACAGACGTGATGCTGCCGTGTTTTTCGTAGACG
TCTGAATGTAGAAGAACACATGGCTTGAATGTACACGCATCGATCCTTCTCGTAAGATGCCCAATGTAGAGCAAAACACTATACTTTGAAATCGTACTCGATTTGAAAGAGATAAGTACA
CGTACAACAGACGCATGCAAGAAAAAAAAAAAAGGTGGTACCTTCCGCACAATCATAAAGCCTCTTAATTTAGTGCACTCCCTCGGCCGCAATTCCTTGTACATTCTGATGCGCATGCAT
CAGTCCTCCTCGCAAAGTGCCAGGCAATGCAGAACAAAAAACGATTTTGAAATCGAGCTCGATTTGAGCGAGATAACAGTCAAAACAACAGGGCACAGAAAGGAGAAAAAAAGAGGCTTC
AGCCCAAACGCCTCTTCGTATTTTTTTCGCGCTTCGCGCGAAATTAATATAACTCGTTCCCGGGTTGCCCTACCCATGGTCGCTGAGCCCTTCTCCGCGCAAGTTCTCGGCGAGAGCAGC
AAGCTAACACACTTCGCGCTGCATACCTTCCCTGGACCTCAAAACAACAATCCAGCTCCAGAATGAAGGCATTCGCTGCTTGTGTCACCGCGGTGGCGGCGCTGGACTGCGCGTCAGCCT
TCGTGGCGCCCGTGGTGACCTCTAGCTTTGCCAGCTCGTCGCTGAGCCGCACCTCCGCTCGATCGCGCGCCCCCGGAGTGCTACGTATGTCTTCTGCAGTGTCCACTGACGCGAAG
GTGT
GGTGGTGCACCTGCAGAGCGGTAGCTAGGAGAGTCAATCTTGCGTAGCACGTGGATCAATATTTCAGGCGTGGTAGTTTGCTGGATGCACGTCCTTCGTGGTGGTGGTGGTGGGTGGGGA
GATAATAGACGTCGTCGGAAAGTACGCATGTGTGAGTCAGCGAGTTGCGGTTGATGCTGGCGGGGTCGCCGGCCCAGCTTCTTCCCACTTTGTTCAACGTTTGTTCCTGTTTTTTGCCAG
CGGGAAGGTAGCAACGCCTTGGAAACTATGGTCTCGTTGCCTGCTGCCTGTTAGCAAAGCATTCCCTGCCAGTGTTGGAATCACGTGCTCAGCCCCGACACCAGTGAAAAACAAGAGCGG
CGCACTTCATTTTTCACCCGCCGTGAGAGCTTGCCGTGCGGCTCTAAGCCATACAGATTACTCGCAAGTGCAGCAGGTCATGTTCATCATTGCAGTTTGCAGCGCGGTTTTGTGTGGAAC
AACTCCCTGGTGTGCGCCTACCAGTTGCATTGCATCCTCACAGCAGGCAGTTCCACTGCTGTTTGCGAAAGCCGTGTGGCCGGGAGAGGGCCTACTGCTGTAGCCAGCGAAAACCCGGTC
CCTCCTCAGCCGATGCACAAACATGAGTCTTGGCAGCAGCATCACGTCTCGATCGAAGGCGGTTGCACATATACATATATGCATGTTGCCTTCAACATCAGCAGCAGCAGCAGCAGAGCT
AGTATGGCGTCTACAGCAGTAGTAGCGTCAGAAGCGGTGCGCTCCTTCCGGCCCTTTCTGTGTACTAAGGTGCCAGTAGCTTAATTCGGTCTCTTTGCCTCTCTCGCGAATGGATGGTTG
GTCCGTTCACGATCTTGCGCATACAGCGAAGGAATATAACATTCAGATAGATGCGCAAGATGGCTGTGCCAAACTGTCTTGTTGAGCCTGTTACCCACACGGGAGATGTCGCTGTATGCT
GCTCGGGAAATCGTGAAAATATAGGTAACCTCCACTGACGCTGGAGTCCTTGCTAATCTACCGTACACTCTTTTCTTACACTTGAAAAATAAGTAGATAAGAGATGGATTCGTTGTGCCA
TACAAGTGAAAAATAAAACTCGCACAGCTCGCGGCCCGCAGTATGTGTAACCCGTTGCAATTTTGCCAAAATACCACCGCCGTACACAACACAAGGTAACACACCCAACATAGGATTGCA
CACGCCCGGCAGAAGACACACCCGTTGATAATAAAAGCCCAAAACACGATGGCTACTCTTAGATCAAATCAAACACATCCCGTTCGACACCCTGTGGGTGTATCTCGAATGGGTATAATA
ATCTTTCTGTGTGCGTATTTATTTTACCTAATTATTCAGGAGGGGAGGGTAGAGAGGGGTGGGCTCTTCTGTGTGACCACGGGTTGGGAGTAAACGGCACTACAGTAGTAGTGCTGTGAG
CTCTGATTTGAAGTGACGACAAAAAAAAAAAAATGAAGAGGGGCGATGATACAACACACACACGGTGATCGTGTTTTTCCACTGGCCAAATTTTTACTCGTTACCCGGTGTTTTCCTGTC
TGTGTAGAACGGTTTGTCACTGGTACGAATTTCACTGAACAGCTCGTCTTCTCTTCGAGTGTGCTGTTGGCTGATATCAGGTACAGCAGTGCTCAATGTGTCTTATCATTTCTTGTTGTT
GGTCTATTGGTATGATGATGCTCTCTTCGCGAAAGGTGGCGGCTTTGCAAGAGTGCAAGAAGGAGCTCGCGGGCATGATCGACAAGACCAACTCGCACCCCATCATGATCCGACTTGCGT
GGCACGATGCCG
GTGAGTTGTTGTTGTTGTCGTCGTCTTCGTTGTCATTGTTTTGGTCGTTGTTGATGTTGTTGCTGTCGTTGTTTTGGTTGCTGGTGGCGTTGTCAGTGTGTTTTTCTC
CTCTTGACATCGACGAAAAAAGACGAGAACGAACCCTTGTTTGCTGCTGCCCTTGCTTTGTCTCCGCTGGACAGGGACGTACAACAAGGACAGCACCGAGGGGTGGCCGAGGTAAGATGA
AACACCGCAAAAACGCGTACACTGCATAGTAGAAGGAACTCCGCTGCAACGAGCGCCGAAAACGACGATTTAGCCGTGAGACAACAGGCCGATGCATACGCACGGCTGGAAGCAGACAAT
ATTCCGCGCGCTGTAGAACTATTACTAAACAGCTAAACTAATAGTTGGGTAAGGATTAAACTACGGGTAGTTGAACCGTACTTGCACAAGATTCTGACCGAGGAGTTGTTCAGAAACAAC
TATTTAGTTGCAAGATTCTGACCGAGGAGTTGTTTAGAAACAACTAATTGCACAAGATTCTGACCGAGGAGTTGTTTAGAAACAACTAATTGCACAACATTCTGACCAAATGAACAGTTG
TTTGGCAAAACAGAAACACAACTATCGTAGTTGTACAGGCTCTGCAAGTATTGGCATAGATTTTCATGTGGGCAGGGCGAGGTTTTCGGTAGGGTCGGGTGGAATCTGCGGCGGCATCCG
CGCAGCGGCTGGCTCCCAGGGGGAGAGACCATGAACAGGAACACCGCTGTTGAGTTCGGCAGCCGAACTGCTCACGCTGTTGAAGATGACGAAGTTTGTACACGGCACACTCGTGATTCA
CGGAGCGCTCTCAACAAGGCTGCGTTGTCTTGAGATGTTGGCGTTGTGGCAGCCATCCATGCAGAAGGCACGCGGAGTGTCAGCGTTGAAAGTCCACTTGCTTTCAAAGCAGAAAACGTT
CCGTTTCGACATTAAACCGCCAGGTCAAAAGCCTCGAGAGTTGGTAAAATCTACGCCAGCTTTTTTTGAGCGACACGCAAGAAATACAGTGTTACCCGACCACGTGGCACGGGGCCATGG
GGGGGAGCGGAGGGCTCCAGACTATCTGTCTCTGTTGTTTTTTTATCGTTTTGCGGACCCTTCCGGTCCATTTTTTCTACCGTACTAAAGCTTTTCTAGCGTAACTGGTAGATGCATACG
AACTGAAGGAGGCACTGGGCGGGCAGATCCGACCGGGCAGATCCGACCGGCTTCTACTGTGAAGACAGCAACAACATGATACCTTGTAGGCATCAGCTGCCCCTCACCTTCGATTCAAAT
CGCGTCACACACGCCTACCAGACAGGGGGGAGCTAACGGGTCCATCCGCTTCGAGCCGGAGATCAACCACGGCGCTAACGCCGGCCTGACCACGGCCCTGAAGCTCCTCACGCCGATCAA
GAAGAAGTTCGAGGAGGTCGGCTGGGCGGACCTCATGCAGCTCGCCTCGGCAACGGCTGTCGAAGTCGCCG
GTAAGCACAGGACAAACGGAACGATCAAGCCGGCACTTTTGTTGACGTA
GAAATAAATCGTGTCGCGGTGGCTGGTGGTAAAAGCCAAAGAAAGGAGAGAGAGAGACGAATCAAGCAAACAATCAATAAAAGGAGAGAGAGAGACGAATCAAGCAAAAAATAGGACGTG
TGAATCACCTTTTTCGCGGAGCGTGATGCGCAAACGGGCATAAATGTTCCCTCCACTGCTTGTGCGAAAGTTGGAGGTTGATAAAAATATAAACGATTTTTAGATGTACGCATGGTATCG
TAAGAGTAGCCGCGTCACCCTGGCATTGCTGGTACACGCAGTATGCGCCACCGGCGATCTCACGGGCCAAAGTTGCTGCCAGGCACACGACCACAACGTGCACACCCACTCCCTCGCGGT
CTGTTGTCTCTCCTATGATATTCGCATTCGTTGTCGTGCCCTAGGGGGACCCGCGATCGACATGAAGTACGGCCGCAAGGACGCGGTAGCACCGGAGGACTGCGTGGACGAGGGATCCCT
CCCCGCCGGGAACAAGCCTTTCCCGGACGCCGACAACGCCCAG
GTGGGTTTGTACAGTCAGCCTGTCTGATGATAAATATTTACTTCTTCAAATCCGTTGAGGAAAGTTTCTGATGGGAC
GTTATCTGGCCGTTGATGTTTTCTGCACACGCGGAAGGAAGGGTGCATAGAGAATCGCGTAGTAGGTCTTTCGTTGTCTCCTGCTTGTTCATGCCGCAGGTCTGGTTCTCCTGGACACGA
CATGCCAGACCACACCTACATATGTGTAGGTGTGCTGGGGTGTCTGTTCTTGAGGCATACATTCTGAGCCCGCTCAGCGTGGAAGCTTATACATGGGTGGAATATATCTTTTATTTTTTT
GTTGCGATTTTGTTTCTTGAGCACCACCTTCGCAACGTGTCTTTTCCTCTTCGCGTTGTACCTTACCGTTTGAAATGGCCGTTCTTTTAGTGTAGTTTTTTCGATTTTGTGTCGTAAGGA
CCACCTGCGCAACGTGTTCTACCGCGTCGCCTGTGCTCGAACATTATGTTAAAGTTGAACGTATCGTCGTTGTGTTTTTTGTTGCTTTTGTGATTTTGTTTCGTCAGGACCACCTGCGCA
ACGTGTTCTACCGCATGGGGTTCGGTGACGAGGGGATCGTTGCTCTGTCCGGGGCCCACACGCTGGGGCGTGCCTTCAAG
GTGAGAGTCAAGAAAAGACAAGCAAGACATCGGACTACTG
CTGTTGCCACGGCTTTTGCCAAACATGCAATCCACAACCTTGCTCGGTGTTGGTCGAACATGCAATCCACAACCTCCTCTCTCGGTGTTATCGTGGAGCGGTGCGGTGCCCTTGTTGCGG
GTTCCGTTGTATTGGCTCCTCTTCCGACACGATGACGGCAGCAGGTGCTGGTGGCGGCTTCTGGTGTTCGTATTGTGGGGAGTTTCGGGCATGAATTTTGAATTTTGCACCTTGATCCGA
GGAGCAAATCAGGATGATGCCGCGGTTTCGTGATTTCCGTGTCACTGCCCCACGCGCCAGCGGCCTTGTTCGCCGAGAGAGGGTTTTACTCAGCACATTGTTGGATGTCTTCGGCGTAGG
TTGCATAGGATTCCACGACCCCTGGGCCCATTTCCATGTTCAAAGCTTGATTACTCCGCGAAAAACACACTGCGACGGTGCTCAAAATGATACCGTTGGAACTGTCTCGTCTAGAGCTTT
CCGAAAACATGTGATTTATCTTGATGGCATCCTGTTCGCCGTGGAGTGGCCGAGCTTTGAAAACGGGTCAGGGGGTGTGTTACCTTACGCACGCTAACGTATTCCGCTTGGCCATTGTAC
CGGGTCGCGCCGTTTCGGGGGTATATTTTGACTCTACTGACCACTTTTTGGTATTTTTGTTGTCATCCCACGCGACAGTGTGTAGATTACACCCGTGTCGGAGGCTGTATTTGCGCTAAC
TACAAAAATGATACCTTGATGTTTCTTTTCTCCAATCGAAAGCAACCCCAACCACCGTCCTACATGCTCGACTCACACTCAACCTTGACAGGACCGCAGCGGGGAGGGAGCGGAGTCTAC
GAAGTTCACCTCCGGCGACCACGTCGCCCGCGGGGACGGCAAGGCCGGCTACGGGCGCAAGGGCGGGAGCTCGTGGACTGAGAAGTGGCTCAAGTTCGACAACAG
GTGATGAATGACGTT
CTATCAATACTGTACTCTGTAGGATGATCGGATATCACAGCCTAAGGTGTTTTATTTTGAACCATTTTGAACCATGTCCGCGCGAAGACAAAGTAAAAGGGTGACGCTTGTAGGATGATC
GAGGAAGTGTGATGAGGCTAAGGTTTCTTGACTACATCTGCCGGAAGAAAACAAAAAACTAAAGACATGACGCATTTAGCATGATGAGGGTTTTGTAACCATATCTGCCCGAAGACCAAT
AAAAAAGAAAAACATGACGCATGAGTGTGATGAGGTTGAGGTTTTCGTGACCACATCTGCCGGAAGACCAAACAAAAGGCAAAAAATAATGACGCATGCGCAAGTGTCCCAAGAGGGCGA
GGGTCGCTTATTCTTCCCCGAGAGCCGTTGGCAAGATCATTTCACCATACTTGGGCTCGAGTCTCGATGAAGCAAGCGTTATGAAACACGGTAGGGTCGTTAGGTAAAGACCATGTCGCA
ACGTTTCCCCCGAGCGAGAACACCCAAGACCATTACGGAATATTTTGGCTTGACCATCGATAGAACAAGCGTATATCGTTATTGTGGTAGCGGGTCGTTGAGAACGACCTTGTCGCTCAT
GACGCTTGTCGTTTTCCTTTCGTATTGTTTTGTACCACTTGTACTTGGTTGATCAAGACGATGTCGCTCATGCCGGTTCCTTTCTCGTTCTACTGTATTCTACTGTTTACATATATATAT
ATATTTTTTTTCCAGCTACTACGCCACGGTACCCGACGAGGCGTCTGACCCCGAGCTGCTTAAGCTGGGCACCGACAAGTCCCTGTTCGATGACGAGGGCTTCCTCCCCTTCGCGCAGAA
GTACAGGGACAGCGAGGAGGCTTTCTTCGAGGACTACAAGAAG
GTGGGTACTGCCTGCATTTATGTACAAAGTATACTTTGAGAATATTGTTATTATTATTCTTATTGTTTTTTTTTCGT
CCGGTCTGTTACGGCGCCGGTGTATAGGAGGCCTTCTTCGGGGACCTCTTTTGTTTTACTATGTGCTGCTGTAACCGTCATTTTTTTTTTTTTATTTGATTACAAGCACCGCCCGTCGTG
TTATTTCAGTGTTATTTTTTTTTGTTTTTTTTTACTACAAGCACCGCCCGTCGTGTTATTTATTATCTCTTAATTCATTTTTTTTCTTCTTATAGTACAATACACAACAATTTTGTTTCT
TCCGAGATAGCAATTAATTCATCAGTGTTGTTCGTCGGAGCTTTTCGTACTTTTTTTTCTTAGCTGAAGGCATGGGCATGTTGTGTTGGGTGAAACAGCGTGAGTAGTGTCCCCATGTGT
CAATTCCTGCGGCTTCTAATCGTACATAACCGGTGGGACTTGTTCCAATTTTTTTCTCCGTTACGTCATCTGTTGAGTTATGTGGCTTTTTGAGTTGTGGAGGGTAAGGGAGCAACCACA
ACGCGTGTTTGTCCTTTCGGTGAAAGTCAATCTCAACCGGCCAATAAACCACCGAGGAGGGACATACGACTCAGGCGTTTGGCTTTTGGCACAGACAGCTGTGAGATTGAGGAACATGCA
CGCACAGCGCTCCTGGATATTTTTTCTTTGGTTGGTTGTTTCAATCCCGCTGGGTTTGCCACGCCTATGGAGCACTTCGTCGTATGTTTGTTTCATGCCCCCCCCTCCGTCCTCTCGAGG
ACGGGTGGTCAATAGTCTGACCGCTAAGGCATGGAAAAACATGAGTTCCTCCCCACCCCTGACGTTTGTTGTATTGTATGTCGTCCCCCCCGCCCTCCCCTTTGGTTTGCAGGCGCACAA
GCAGCTCGCGGAGCTCGGCGTAGAGTGGGAAGTCGAGGGTGGCATCTCGATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAGCCCTTCTCCGCGCAAGTTCTCGGCGAGAGCAGCAAGCTAACACACTTCGCGCTGCATACCTTCCCTGGACCTCAAAACAACAATCCAGCTCCAGAATGAAGGCATTCGCTGCT
TGTGTCACCGCGGTGGCGGCGCTGGACTGCGCGTCAGCCTTCGTGGCGCCCGTGGTGACCTCTAGCTTTGCCAGCTCGTCGCTGAGCCGCACCTCCGCTCGATCGCGCGCCCCCGGAGTG
CTACGTATGTCTTCTGCAGTGTCCACTGACGCGAAG
GTGGCGGCTTTGCAAGAGTGCAAGAAGGAGCTCGCGGGCATGATCGACAAGACCAACTCGCACCCCATCATGATCCGACTTGCG
TGGCACGATGCCG
GGACGTACAACAAGGACAGCACCGAGGGGTGGCCGAGACAGGGGGGAGCTAACGGGTCCATCCGCTTCGAGCCGGAGATCAACCACGGCGCTAACGCCGGCCTGACC
ACGGCCCTGAAGCTCCTCACGCCGATCAAGAAGAAGTTCGAGGAGGTCGGCTGGGCGGACCTCATGCAGCTCGCCTCGGCAACGGCTGTCGAAGTCGCCG
GGGGACCCGCGATCGACATG
AAGTACGGCCGCAAGGACGCGGTAGCACCGGAGGACTGCGTGGACGAGGGATCCCTCCCCGCCGGGAACAAGCCTTTCCCGGACGCCGACAACGCCCAG
GACCACCTGCGCAACGTGTTC
TACCGCATGGGGTTCGGTGACGAGGGGATCGTTGCTCTGTCCGGGGCCCACACGCTGGGGCGTGCCTTCAAG
GACCGCAGCGGGGAGGGAGCGGAGTCTACGAAGTTCACCTCCGGCGAC
CACGTCGCCCGCGGGGACGGCAAGGCCGGCTACGGGCGCAAGGGCGGGAGCTCGTGGACTGAGAAGTGGCTCAAGTTCGACAACAG
CTACTACGCCACGGTACCCGACGAGGCGTCTGAC
CCCGAGCTGCTTAAGCTGGGCACCGACAAGTCCCTGTTCGATGACGAGGGCTTCCTCCCCTTCGCGCAGAAGTACAGGGACAGCGAGGAGGCTTTCTTCGAGGACTACAAGAAG
GCGCAC
AAGCAGCTCGCGGAGCTCGGCGTAGAGTGGGAAGTCGAGGGTGGCATCTCGATCTAA

Retrieve as FASTA